Cells were washed in cold D-PBS prior to lysis on ice using lysis buffer (1% NP40, 100 mM Tris pH8, 100 mM NaCl, 10% glycerol, 5 mM EDTA, cOmpleteTM EDTA-free Protease Inhibitor Mixture, Roche Applied Science) supplemented with 20 mM N-ethylmaleimide. Lysates were cleared by centrifugation at 15 000×g at 4°C, and the resulting pellet was discarded. Total protein concentrations were determined using Pierce BCA protein assay kit (Thermo Fisher Scientific), and lysates were diluted to approximately equal concentrations before addition of 4× sample buffer (containing 10% BME) with immediate boiling at 95°C for 10 min. Proteins were separated by 4–12% bis-tris SDS–PAGE (Invitrogen) in 1× MOPS or MES SDS running buffer (Invitrogen) at 100 V, and transferred (1× Transfer Buffer (Invitrogen), 20% methanol) onto Immobilon-FL PVDF membrane (Millipore) for 1.5 h at 100 V. Membranes were blocked in Odyssey blocking buffer TBS (Licor) or 5% non-fat milk or 1% BSA (Sigma, A7906) for 1 h before overnight incubation at 4°C with primary antibodies. Membranes were scanned the following day after 1 h incubation with secondary antibodies using the Odyssey CLx Imaging System or ImageQuant system (Bio-Rad). The following secondary antibodies were used: HRP anti-rabbit (CST, 7074S) and anti-mouse (CST, 7076S) or LI-COR IRDye® 800CW (anti-rabbit) and IRDye 680RD (anti-mouse).
Odyssey clx imaging system
Manufactured by Bio-Rad
The Odyssey CLx Imaging System is a versatile and high-performance fluorescence imaging platform designed for a wide range of applications in life science research. The system utilizes dual-channel infrared fluorescence detection to capture precise and quantitative data from various sample types, including Western blots, gels, and microplates. The Odyssey CLx delivers high-resolution images and accurate quantification of target proteins or other biomolecules.
Automatically generated - may contain errors
Lab products found in correlation
Complete edta free protease inhibitor mixture, by Roche (1 mentions)
Mes sds running buffer, by Thermo Fisher Scientific (1 mentions)
Bis tris sds page, by Thermo Fisher Scientific (1 mentions)
Irdye 800cw, by LI COR (1 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (1 mentions)
Immobilon fl pvdf membrane, by Merck Group (1 mentions)
Odyssey blocking buffer tbs, by LI COR (1 mentions)
Tbe urea gel, by Bio-Rad (1 mentions)
Image studio lite, by Bio-Rad (1 mentions)
2 protocols using odyssey clx imaging system
1
Western Blot Sample Preparation
2
AGO2-Mediated miRNA Cleavage Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AGO2 cleavage assay was performed as previously described by Gregory et al. (83 (link)) and the following modifications. Oligo RNAs were purchased from Integrated DNA Technologies (IDT): dme-let-7a-5p_guide (/5Phos/UGAGGUAGUAGGUUGUAUAGU), dme-let-7a-3p_passenger
(/5Phos/UAUACAAUGUGCUAGCUUUCU), and dme-let-7a_target (/5IRD700/UAUACAACCUACUACCUCAUU). miRNA duplex was prepared by mixing equal volumes of both dme-let-7a-5p_guide and dme-let-7a-3p_passenger oligos in annealing buffer [10 mM tris (pH 8), 50 mM NaCl, and 1 mM EDTA], incubating at 95°C for 3 min and cooling gradually to room temperature for 1 hour. Either 0.025 μg of rAGO2 (Active Motif, #31486) or rAGO2 in combination with increasing concentrations of affinity-purified Flag-INTS11 was preincubated with the 5 nM miRNA duplex in buffer containing 3.2 mM MgCl2, 1 mM adenosine triphosphate, 20 mM creatine phosphate, RNasin (0.2 U/μl), 20 mM tris-HCl (pH 8), 0.1 M KCl, and 10% glycerol for 30 min at 37°C. Then, 10 nM dme-let-7a_target was added, and the cleavage reaction was incubated for 90 min at 37°C and stopped by adding proteinase K for 30 min at room temperature. Samples were loaded onto a 15% TBE-urea gels (Bio-Rad, #4566055), visualized using the Odyssey CLx Imaging System, and quantified by Image Studio Lite (v5.2).
(/5Phos/UAUACAAUGUGCUAGCUUUCU), and dme-let-7a_target (/5IRD700/UAUACAACCUACUACCUCAUU). miRNA duplex was prepared by mixing equal volumes of both dme-let-7a-5p_guide and dme-let-7a-3p_passenger oligos in annealing buffer [10 mM tris (pH 8), 50 mM NaCl, and 1 mM EDTA], incubating at 95°C for 3 min and cooling gradually to room temperature for 1 hour. Either 0.025 μg of rAGO2 (Active Motif, #31486) or rAGO2 in combination with increasing concentrations of affinity-purified Flag-INTS11 was preincubated with the 5 nM miRNA duplex in buffer containing 3.2 mM MgCl2, 1 mM adenosine triphosphate, 20 mM creatine phosphate, RNasin (0.2 U/μl), 20 mM tris-HCl (pH 8), 0.1 M KCl, and 10% glycerol for 30 min at 37°C. Then, 10 nM dme-let-7a_target was added, and the cleavage reaction was incubated for 90 min at 37°C and stopped by adding proteinase K for 30 min at room temperature. Samples were loaded onto a 15% TBE-urea gels (Bio-Rad, #4566055), visualized using the Odyssey CLx Imaging System, and quantified by Image Studio Lite (v5.2).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!