Hucct1

Human CCA cell lines, HuCCT1 (Cat#CL-0725) and HCCC-9810 (Cat#CL-0095) were purchased from Procell (Wuhan, China), TFK-1 (Cat#BFN60808817) was purchased from Bluefbio (Shanghai, China), HuH28 (Cat#CTCC-003-073) was purchased from Meisen Chinese Tissue Culture Collections (Zhejiang, China), QBC939 and SK-ChA-1 were obtained from Guangzhou Medical University (Guangzhou, China). One human embryonic kidney HEK293T (Cat#CRL-3216) cells was purchased from American Type Culture Collection (Manassas, VA, USA). HuCCT1, HCCC-9810, HuH28 and QBC939 were cultured in RPMI-1640, TFK-1, SK-ChA-1, and HEK293T cells were cultured in DMEM, all were supplemented with 10% fetal bovine sera, 100 units/mL penicillin and 100 units/mL streptomycin. All cells were maintained in a humidified incubator at 37 °C with 5% CO₂.

The human ICC cell lines HCCC-9810 (CVCL_6908), RBE (CVCL_4896), QBC-939 (CVCL_6942) and HuCC-T1 (CVCL_0324) were obtained from Procell (Wuhan, China). All cells were cultured at 37°C in a constant temperature incubator in RPMI 1640 medium (Gibco, Carlsbad, USA) supplemented with 10% serum.

We obtained CCA cell strains including HUCCT1, RBE, CCLP-1, huh28, QBC939 and HCCC-9810 from Procell (Wuhan, China). All cells were cultured in Roswell Park Memorial Institute 1640 medium (Gibco, USA) supplemented with 10% foetal bovine serum and incubated at 37℃ with 5% CO₂. An EGFP-Puro-CMV-3 × Flag hSPRYD4 vector was constructed by Generay Biotech Co., Ltd. (Shanghai, China). Mixed with the pPACKH1 packaging plasmid, the SPRYD4-OV vector was transfected into 293 T cells. The virus particles were collected from the concentrated virus precipitation solution following the SBI instructions. The cells were infected with TUNDUX virus transducers. Following this, puromycin screening was used to identify the positive cells. For the generation of cell lines with SPRYD4 knockdown, two siRNAs targeting SPRYD4 were transfected into CCA cells to silence SPRYD4. The siRNAs used in the study were obtained from sequences (5’- 3’) shown below:

GCCCCAAAUCAGAAAAUAAAC

AAGGCGCAAGAUGGCGCUGCU