The DNA Blood Mini Kit by QIAGEN® (Hilden, Germany) was used in genomic DNA extraction. The detailed description of the genotyping could be referred to in Shiffert’s paper [6 (link)]. In brief, the restriction enzyme BseDI (fermentas) was used to digest the PCR products. The GNB3 C825T polymorphism was visualized as 116 bp and 152 bp fragments for CC genotype; 268 pb fragment for TT genotype; and 116 bp, 152 bp, 268 pb fragments for CT genotype. A laboratory assistant blind to the clinical status of individual participants performed all assays and obtained genotype assignments following two accordant experimental results. We sequenced approximately 15% of random samples directly. Moreover, all of them were consistent with previous genotyping results.
Bsedi
Manufactured by Thermo Fisher Scientific
Sourced in Germany
BseDI is a type II restriction endonuclease that recognizes and cleaves the DNA sequence 5'-CCNNNNN↓NNGG-3'. It is commonly used in molecular biology applications such as DNA digestion and fragment analysis.
Automatically generated - may contain errors
Lab products found in correlation
Qiaamp dna blood mini kit, by Qiagen (3 mentions)
Taq dna polymerase 2x master mix red, by Ampliqon (2 mentions)
Dna blood mini kit, by Qiagen (1 mentions)
Dna polymerase, by Promega (1 mentions)
Haeiii, by Thermo Fisher Scientific (1 mentions)
Van91i, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna mini kit, by Qiagen (1 mentions)
Taq dna polymerase 2 master mix red, by Ampliqon (1 mentions)
6 protocols using bsedi
1
Genotyping of GNB3 C825T Polymorphism
2
Genotyping by PCR-RFLP Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene was amplified by polymerase chain reaction (PCR) on 96-well Amp PCR System 9700 Thermocycler (Applied Biosystems). Primer sequences, PCR conditions, and restriction enzyme digestion were as follows (oligonucleotides were synthesized by Promega). The forward primer was 5′-TGACCCACTTGC CACCCGTGC-3′, and the reverse primer was 5′-GCAGCAGCCAGGGCTGGC-3′ (primers accession number: >NC_000012.12). PCR was carried out in a 50-µL reaction volume containing 100 ng of genomic DNA, 0.4 mmol/L of each primer, 0.2 mmol/L dNTPs, 2 mmol/L MgCl2 in 10% PCR buffer, and 1U of DNA polymerase (Promega, UK). PCR involved a first denaturation step of 95 °C for 5 minutes, which was followed by 35 cycles at 94 °C for 1 minute, at 60 °C for 45 seconds, and at 72 °C for 1 minute. The reaction was completed by a final extension step at 72 °C for seven minutes. Aliquots of 5 µL of the PCR products were digested with BseDI (MBI Fermentas). Restriction fragment length polymorphism (RFLP) products were analyzed on 2.5% agarose gel, stained with ethidium bromide, and visualized with ultraviolet transillumination. A 25 base pairs (bp) DNA marker was used, it ranged from 25 to 300 bp (Promega). The CC genotype gave two bands of 115 and 152 bp, CT was expected to give three bands of 267, 152, and 115 bp, while TT gave one band of 267 bp. Figure 2 .
3
Genotyping Genetic Variants in Blood Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from venous peripheral blood leukocytes (using a QIAamp DNA Mini Kit; Qiagen, Hilden, Germany). The polymorphisms COL1A1 rs1800012 (c.1245G>T), COL1A2 rs42524 (c.1645G>C), MMP1 rs1799750 (c.-1607G>GG), and MMP9 rs3918242 (c.-1562C>T) were analyzed by PCR and restriction fragment length polymorphism (RFLP) analysis (all rs numbers are from the dbSNP database, (http://www.ncbi.nlm . http://nih.gov/snp ). The primer pairs (TIB MOL BIOL, Poznań, Poland) used were for COL1A1 rs1800012: forward 5′-GGAAGACCCGGGTTATTTGC-3′ and reverse 5′-CGCTGAAGCCAAGTGAAATA-3′; for COL1A2 rs42524: forward 5′-AGTAATACCTGAGGCTTTGAGACA-3′ and reverse 5′-GAGAGGTACGGTATGGTGATTTA-3′; for MMP1 rs1799750: forward 5′-GAAATT GTAGTTAAATCCTTAGAAAG-3′ and reverse 5′-TATGGATTGCTGTTTTCTTGC-3′; and for MMP9 rs3918242: forward 5′-GCCTGGCACATAGTAGGCCC-3′ and reverse 5′-CTTCCTAGCCAGCCGGCATC-3′. The PCR products were digested with restriction enzymes Van91I, BseDI, EcoNI, and HaeIII, respectively (MBI Fermentas, Vilnius, Lithuania), and the digestion products were separated in 3% agarose gels. Both negative (no DNA template) and positive (genotype-confirmed DNA template) control samples were used in the PCR-RFLP analyses. All samples were independently genotyped using a blind method in duplicate.
4
Genotyping GNB3 rs5443 Variant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from 200 µL EDTA-treated blood with the QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany). The polymerase chain reaction (PCR) was performed with 2 µL genomic DNA and 30 µL Taq DNA-Polymerase 2× Master Mix Red (Ampliqon, Odense, Denmark) with the following conditions: initial denaturation at 94 °C for 3 min; 38 cycles with denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and elongation at 72 °C for 30 s each; final elongation at 72 °C for 10 min (forward primer: 5′GCCCTCAGTTCTTCCCCAAT3′; reverse primer 3′CCCACACGCTCAGACTTCAT5′). PCR products were digested with BseDI (Thermo Scientific, Dreieich, Germany), and restriction fragments were analyzed by agarose gel electrophoresis. For the various genotypes, the results of restriction fragment length polymorphism (RFLP)-PCR were validated by Sanger sequencing. The Hardy–Weinberg equilibrium (HWE) was calculated with Pearson’s chi square (χ2) goodness-of-fit test, and samples were considered to be deviant from HWE at a significance level of p ≤ 0.05. Genotypes for GNB3 rs5443 were compatible with HWE (χ2 = 0.03; p = 0.87).
5
Genomic DNA Extraction and RFLP-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from 200 µl EDTA-blood using the QIAamp® DNA Blood Mini Kit (Qiagen, Hilden, Germany). Polymerase chain reaction (PCR) was performed with 2 µl genomic DNA and 30 µl Taq DNA-Polymerase 2x Master Mix Red (Ampliqon, Odense, Denmark), with the following conditions: initial denaturation 94°C for 3 min; 35 cycles with denaturation 94°C for 30 s, annealing at 66°C for 30 s, and elongation 72°C for 30 s each; final elongation 72°C for 10 min (forward primer: 5′ GCT GCC CAG GTC TGA TCC C 3' and reverse primer 3′ TGG GGA GGG TCC TTC CAG C 5′). PCR products were digested with BseDI (Thermo Scientific, Dreireich, Germany), and restriction fragments were analyzed by agarose gel electrophoresis. The various genotype results from restriction fragment length polymorphism (RFLP)-PCR were validated by Sanger sequencing.
6
Genotyping of DNA Variants via RFLP-PCR and Sanger Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from 200 µl EDTA blood using the QIAamp® DNA Blood Mini Kit (Qiagen, Hilden, Germany). Polymerase chain reaction (PCR) was performed with 2 µl genomic DNA and 30 µl Taq DNA-Polymerase 2x Master Mix Red (Ampliqon, Odense, Denmark) under the following conditions: initial denaturation 94°C for 3 min, 38 cycles with denaturation at 94°C for 30 s, annealing at 60°C for 30 s, elongation at 72°C for 30 s each, and final elongation at 72°C for 10 min (forward primer: 5′ GCCCTCAGTTCTTCCCCAAT 3'; reverse primer 3′ CCCACACGCTCAGACTTCAT 5′). PCR products were digested with BseDI (Thermo Scientific, Dreireich, Germany), and restriction fragments were analyzed by agarose gel electrophoresis. For the various genotypes, results from restriction fragment length polymorphism (RFLP)-PCR were validated by Sanger sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!