Abi 7900ht real time pcr system 7900

Total RNA was obtained from HBMScs using Trizol Reagent (Thermo Fisher Scientific), and reverse transcribed into first-stranded cDNA sequences using a miRNA cDNA Synthesis Kit (YB130911-25, Ybscience, Shanghai, China) or a PrimeScript^™ RT reagent kit (DRR037A, TaKaRa, Japan). The amplification of miR-103, SATB2, RUNX family transcription factor 2 (RUNX2), bone gamma-carboxyglutamate protein (BGLAP), and secreted phosphoprotein 1 (SPP1) was performed by qPCR using the cDNA as a template on the ABI 7900HT Real-Time PCR System 7900 (Applied Biosystems, Carlsbad, CA, USA). The primers of the genes were listed in Table 1. Thermocycling conditions of PCR amplifications were performed in duplicate at 98°C for 15 s, followed by 40 cycles of 95°C for 10 s, 60°C for 30 s, and 72°C for 45 s, finally 4°C for 30 min. The relative levels of target gene expression were quantified using the 2^-ΔΔCq method [23 (link)]. small nuclear U6 RNA was used as an internal reference for miR-103 expression analysis, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as an internal control for other genes.

Total RNA was extracted using RNeasy Protect Mini Kit (Qiagen), followed by quality control with gel electrophoresis, and cDNA was reversely transcribed using RT‐PCR Quick Master Mix (Toyobo). The fluorescent quantification was conducted using SYBR^® Green Realtime PCR Master Mix (Toyobo) in ABI 7900HT Real‐Time PCR System 7900 (Applied Biosystems). The thermal cycle parameters were as follows: 5 minutes under 95°C; 30 seconds under 94°C, and then 30 seconds under 61°C for 40 cycles. GAPDH was used as an internal reference, and ITGA7 mRNA expression was calculated by the method of 2^−ΔΔCt. Primers were as follows: ITGA7, forward primer (5′‐3′): GCCACTCTGCCTGTCCAATG; reverse primer (5′‐3′): CGGAGGTGCTAAGGATGAGGTA; GAPDH, forward primer (5′‐3′): GACCACAGTCCATGCCATCAC; reverse primer (5′‐3′): ACGCCTGCTTCACCACCTT.

For further validation, we acquired the frozen-fresh NSCLC samples (n = 40) that were still available in the storage to detect the katanin P60 mRNA expression using RT-qPCR. The total RNA was extracted from frozen samples by RNeasy Protect Mini Kit (Qiagen, German) following the manufacturer’s instruction and then reversely transcribed into cDNA using RT-PCR Quick Master Mix (Toyobo, Japan). Following was the fluorescent quantification using SYBR® Green Realtime PCR Master Mix (Toyobo, Japan) in ABI 7900HT Real-Time PCR System 7900 (Applied Biosystems, USA). GAPDH was used as an internal reference and katanin P60 mRNA expression was calculated by the method of 2^−ΔΔCt. The primers used was katanin P60, forward primer (5′-3′): TGGTTCAGATGGATGGTGTTGGA; reverse primer (5′-3′): TTCTCAAGGCGTCGTCTTAAAGC; GAPDH, forward primer (5′-3′): GACCACAGTCCATGCCATCAC; reverse primer (5′-3′): ACGCCTGCTTCACCACCTT.