Cignal finder pathway reporter arrays

Manufactured by Qiagen

Sourced in United States

The Cignal Finder™ Pathway Reporter Arrays are a collection of reporter constructs that allow for the rapid and sensitive detection of the activation of major signaling pathways in mammalian cells. Each array contains reporters for 45 different signaling pathways, enabling the simultaneous evaluation of multiple cellular responses.

Automatically generated - may contain errors

Lab products found in correlation

Antagomir, by RiboBio (3 mentions) Ribofect cp transfection kit, by RiboBio (3 mentions) Sirna, by RiboBio (3 mentions) Agomir, by RiboBio (2 mentions) Glomax machine, by Promega (2 mentions) Dual glo luciferase assay system, by Promega (2 mentions) Transfection kit, by RiboBio (1 mentions) Mir 34a 5p antagomir, by RiboBio (1 mentions)

6 protocols using cignal finder pathway reporter arrays

siRNA-mediated AK4 Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mimic, ant agomir,agomir, siRNA, negative control (NC) and riboFECT CP transfection kit were supplied by Guangzhou Ribobio, China. And the reporter plasmids in Cignal Finder™ Pathway Reporter Arrays came from SABiosciences, USA. Transfection of both ribonucleic acid reagents or plasmids mentioned in this paper was performed according to the manufacturer’s instructions. The sequences used in this study are as follows:
si-AK4:

GCCTAATGATGTCCGAGTT

5’-GCCUAAUGAUGUCCGAGUU dTdT-3′

3′-dTdT CGGAUUACUACAGGCUCAA-5’

Lei W., Yan C., Ya J., Yong D., Yujun B, & Kai L. (2018). MiR-199a-3p affects the multi-chemoresistance of osteosarcoma through targeting AK4. BMC Cancer, 18, 631.

+ Open protocol

+ Expand

Pathway Activity Analysis in GBM Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Analysis on cancer-related pathways activity was performed using the Cignal Finder Pathway Reporter Arrays (SA Biosciences, Fredrick, MD). GBM cells were seeded into a 96-well white plate and incubated overnight at 37°C. Transient transfection was conducted by adding plasmid construct of transcription factor-responsive reporter of each pathway and controls to cells and incubated overnight in a 37°C incubator. Then, cells were further incubated for 48 hours. Each transfection condition was carried in triplicates. After 48 hours, the changes in expression of each pathway in cells with or without EMP3 depletion were determined by measuring the generated firefly and Renilla luminescent signals using the Dual-Glo Luciferase Assay system (Promega, Madison, WI) on the Glomax machine (Promega, USA). The relative luciferase units were determined by dividing the firefly to Renilla luciferase activity ratio. The luciferase activity of scramble shRNA control was regarded as 100%.

Jun F., Hong J., Liu Q., Guo Y., Liao Y., Huang J., Wen S, & Shen L. (2016). Epithelial membrane protein 3 regulates TGF-β signaling activation in CD44-high glioblastoma. Oncotarget, 8(9), 14343-14358.

+ Open protocol

+ Expand

Pathway Analysis of CEACAM19 Depletion in Cancer Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Analysis on cancer-related pathways activity was performed using the Cignal Finder Pathway Reporter Arrays (SA Biosciences, Fredrick, MD, USA) as described previously.14 (link) Penl1 cells were seeded into a 96-well white plate and incubated overnight at 37°C. Transient transfection was conducted by adding plasmid construct of transcription factor-responsive reporter of each signaling pathway and controls to cells and incubated overnight in a 37°C incubator. Then, cells were further incubated for 48 hours. Each transfection condition was carried in triplicates. After 48 hours, the changes in expression of each pathway in cells with or without CEACAM19 depletion were determined by measuring the generated firefly and Renilla luminescent signals using the Dual-Glo Luciferase Assay system (Promega, Madison, WI, USA) on the Glomax machine (Promega). The relative luciferase units were determined by dividing the firefly to Renilla luciferase activity ratio. The luciferase activity of Scr shRNA control was regarded as 100%.

Hu X., Chen M., Li Y., Wang Y., Wen S, & Jun F. (2019). Aberrant CEACAM19 expression is associated with metastatic phenotype in penile cancer. Cancer Management and Research, 11, 715-725.

+ Open protocol

+ Expand

miR-34a and DLL1 Regulation Pathway

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Homo sapien miR-34a-5pmimics, miR-34a-5p antagomiR, DLL1 siRNA and their corresponding scramble sequences (negative control, NC) and the transfection kit were supplied by Guangzhou Ribobio, China. The mammalian expression constructs for DLL1 (EX-Y3540-M98-5) with GFP tag were supplied by Guangzhou Fulengen, China. Transfection of the ribonucleic acid reagents or plasmids mentioned in this paper and the reporter plasmids in Cignal Finder™ Pathway Reporter Arrays (SABiosciences, USA) has been described previously25 (link). The sequences used in this study are as follows:
si-DLL1: 5′-CCAUAAGCCCUGCAAGAAU dTdT-3′ 3′-dTdT GGUAUUCGGGACGUUCUUA-5′ hsa-miR-34a-5p antagomiR: 5′ACAACCAGCUAAGACACUGCCA 3′ mimics: sense 5′UGGCAGUGUCUUAGCUGGUUGU 3′ antisense 5′ACAACCAGCUAAGACACUGCCA 3′

Pu Y., Zhao F., Wang H, & Cai S. (2017). MiR-34a-5p promotes multi-chemoresistance of osteosarcoma through down-regulation of the DLL1 gene. Scientific Reports, 7, 44218.

+ Open protocol

+ Expand

Modulating miR-34a-5p Expression In Vivo

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mimic, agomiR, antagomiR, siRNA, scramble sequence control (NC) and riboFECT CP transfection kit were supplied by Guangzhou Ribobio, China. The expression construct for CD117 (EX-Z4357-M98) with a GFP tag was supplied by Guangzhou Fulengen, China. Transfection of both ribonucleic acid reagents or plasmids mentioned in this paper and the reporter plasmids in Cignal Finder™ Pathway Reporter Arrays (SABiosciences, USA) was performed according to the manufacturer's instructions. The sequences used in this study are as follows:

si-CD117:

5′-GGAUGAAACGAAUGAGAAU dTdT-3′

3′-dTdT CCUACUUUGCUUACUCUUA-5′

hsa-miR-34a-5p

antagomiR: 5′ACAACCAGCUAAGACACUGCCA 3′

mimics:

sense 5′UGGCAGUGUCUUAGCUGGUUGU 3′

antisense 5′ACAACCAGCUAAGACACUGCCA 3′

Chemically modified mimic oligonucleotides (agomiR) were synthesized to regulate the miR-34a-5p expression in vivo. The 3′ end of the oligonucleotides was conjugated to cholesterol, and all of the bases were 2′-OMe modified. The agomiR oligonucleotides were deprotected, desalted and purified by high-performance liquid chromatography.

Pu Y., Zhao F., Wang H., Cai W., Gao J., Li Y, & Cai S. (2016). MiR-34a-5p promotes the multi-drug resistance of osteosarcoma by targeting the CD117 gene. Oncotarget, 7(19), 28420-28434.

+ Open protocol

+ Expand

Regulation of Rab27B and Serine Racemase by miR-193a

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mimics, antagomiRs, siRNAs, scramble sequence negative control (NC) and riboFECT CP transfection kits were supplied by Guangzhou Ribobio (Guangzhou, China). The mammalian expression constructs for GFP-tagged Rab27B (EX-Q0376-M98-5) and serine racemase (SRR) (EX-W0524-M98-5) were supplied by Guangzhou Fulengen (Guangzhou, China). Transfection of the ribonucleic acid reagents or plasmids mentioned in this paper as well as the reporter plasmids in the Cignal Finder™ Pathway Reporter Arrays (SABiosciences, USA) was performed according to the manufacturer’s instructions. The following sequences were used in this study:

si-Rab27B

5′-CCCUGAUACUGUCAAUGGUdTdT-3′;

3′-dTdTGGGACUAUGACAGUUACCA-5′;

si-SRR

5′-UGCCGUCAGAAGCUUGGUUdTdT-3′;

3′-dTdTACGGCAGUCUUCGAACCAA-5′;

hsa-miR-193a-5p

antagomiR: 5′-UCAUCUCGCCCGCAAAGACCCA-3′;

mimics:

sense, 5′-UGGGUCUUUGCGGGCGAGAUGA-3′

antisense, 5′-UCAUCUCGCCCGCAAAGACCCA-3′;

hsa-miR-193a-3p

antagomiR: 5′-ACUGGGACUUUGUAGGCCAGUU-3′;

mimics:

sense, 5′-AACUGGCCUACAAAGUCCCAGU-3′

antisense, 5′-ACUGGGACUUUGUAGGCCAGUU-3′.

Mimics were composed of double-stranded RNA with no chemical modifications. The 3′ ends of the antagomiR and agomiR oligo nucleotides were conjugated to cholesterol, and all the bases were 2′-O methylated (OMe). All of the oligo nucleotides were deprotected, desalted and purified by high-performance liquid chromatography.

Pu Y., Zhao F., Cai W., Meng X., Li Y, & Cai S. (2016). MiR-193a-3p and miR-193a-5p suppress the metastasis of human osteosarcoma cells by down-regulating Rab27B and SRR, respectively. Clinical & Experimental Metastasis, 33, 359-372.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!