Whole cell lysates were incubated overnight with anti-ezrin antibody (1:1000). Immune complexes were precipitated with protein A/G agarose beads for 6 h and then washed three times with immunoprecipitation buffer. Immunoprecipitated proteins were then eluted with 2 × SDS loading buffer and analyzed by western blotting using anti-Syk (1:2000), anti-myeloid differentiation factor 88 (MyD88, 1:1000), anti-IL-1R-associated kinase 1 (IRAK-1, 1:1000), or anti-ezrin (1:1000) (all from Abcam, Cambridge, MA, USA), as described above.
Anti syk
Manufactured by Abcam
Sourced in United Kingdom, United States
Anti-SYK is a primary antibody that recognizes the SYK (Spleen Tyrosine Kinase) protein. SYK is a non-receptor tyrosine kinase involved in various cellular signaling pathways.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 3000, by Thermo Fisher Scientific (4 mentions)
Anti cofilin, by Abcam (2 mentions)
Anti rabbit hrp, by Jackson ImmunoResearch (2 mentions)
Anti psyk y525 526, by Cell Signaling Technology (2 mentions)
Anti mouse hrp, by Jackson ImmunoResearch (2 mentions)
Anti pcttn y421, by Merck Group (2 mentions)
Pspcas9n bb 2a puro px462 crispr cas9 vector, by Addgene (2 mentions)
Anti cortactin, by Cell Signaling Technology (2 mentions)
Anti gfp, by Takara Bio (2 mentions)
Anti gapdh, by Merck Group (2 mentions)
Irak1, by Abcam (1 mentions)
Anti ezrin, by Abcam (1 mentions)
Donkey anti rabbit igg h l alexafluor 488, by Jackson ImmunoResearch (1 mentions)
Alexa fluor 647, by Abcam (1 mentions)
Anti g3bp, by Abcam (1 mentions)
Anti neun, by Merck Group (1 mentions)
Alexa fluor 594 donkey anti rabbit igg h l, by Thermo Fisher Scientific (1 mentions)
Tcs sp8 x, by Leica camera (1 mentions)
Gapdh antibody, by Merck Group (1 mentions)
Anti p38, by Abcam (1 mentions)
5 protocols using anti syk
1
Immune Complex Precipitation and Western Blotting
2
Immunofluorescence Imaging of Mouse Brain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mice were anesthetized with 1% pentobarbital sodium and perfused with saline for a few minutes. Then, the mice were perfused with 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS). Brains were dissected and soaked overnight at 4°C in 4% PFA, and then soaked in 30% sucrose at 4°C for 48 h. Brain slices (25 μm) were harvested and incubated with primary and secondary antibodies, and then washed in PBST and flat-mounted. The primary antibodies included anti-NeuN (Millipore, MA, United States), anti-G3BP (Abcam, Cambridge, United Kingdom), anti-SYK (Abcam, Cambridge, United Kingdom), and anti-p-SYK (Abcepta, Suzhou, China). The secondary antibodies included donkey anti-rabbit IgG H&L (Alexa Fluor 488, Jackson Immuno Research, PA, United States), donkey anti-rabbit IgG H&L (Alexa Fluor 594, Thermo Fisher Scientific, MA, United States), and donkey anti-guinea pig (Alexa Fluor 647, Abcam, Cambridge, United Kingdom) antibodies. Primary antibodies were diluted at 1:100 for usage, and the secondary antibodies were applied at a dilution of 1:200. In each group, three hippocampus flat mounts were performed and observed under a confocal microscope (LEICA TCS SP8 X, Germany).
3
SYK Knockout in OVISE Cells
4
Rat Aortic Protein Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A rat aortic sample (100 mg) was diced, placed in 1 ml of RIPA lysis buffer (containing one μmol/L PMSF), and fully homogenized, followed by centrifugation at 12,000 g for 20 min. A total of 100 μg of total protein per sample was separated on 10% sodium dodecyl sulfate-polyacrylamide gels by electrophoresis at 120 V for one hour, followed by a transfer onto polyvinylidene difluoride membranes at 100 V for one hour. The membranes were then blocked with 5% nonfat dry milk in Tris-buffered saline containing Tween 20 (0.15 M NaCl, 20 mM Tris-HCl, pH 7.4, and 0.05% Tween 20) for one hour at room temperature, followed by incubation with specific primary antibodies (anti-p38, anti-FKN, and anti-SYK; 1 : 1000 dilution; Abcam, USA) at 4°C overnight. Then, the membranes were incubated with a horseradish peroxidase-conjugated secondary antibody (1 : 5000 dilution; Santa Cruz Biotechnology, USA). The specific protein bands were detected with enhanced chemiluminescence reagent (Amersham, USA). GAPDH antibody (Sigma, USA) was used as an internal control.
5
SYK Knockout in OVISE Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Equal amounts of protein preparations (15–30 μg of total cell lysate, and cytosolic, nuclear, and/or other fractions) were resolved on SDS-PAGE. The antibodies used include: anti-SYK (Abcam, Cambridge, United Kingdom, #ab3113), anti-pCTTN (Y421) (Millipore, #AB3852), anti-cortactin (Cell Signaling Technology, #3503), anti-pSYK (Y525/526) (Cell Signaling Technology, #2710), anti-cofilin (Abcam, #ab11062), anti-GFP (Clontech, #632375), anti-GAPDH (Sigma-Aldrich, St, Louis, MO, USA, #G9545), anti-mouse HRP (Jackson Immuno Research, West Grove, PA, USA, #715-035-150), and anti-rabbit HRP (Jackson Immuno Research, #711-035-152). GAPDH was used as a loading control. The pSpCas9n(BB)-2A-Puro (PX462) CRISPR/Cas9 vector from Addgene (plasmid no. 48141) was used in this study. Cloning was performed using a pair of CRISPR single-guide RNA (sgRNA) specifically targeting exon 2 of SYK; top strand-nicking sgRNA (CGGACAGGGCGAAGCCACCC) and bottom strand-nicking sgRNA (CACACCACTACACCATCGAG) were designed and cloned as previously described.49 (link) OVISE cells were transfected using Lipofectamine® 3000 (Thermo Fisher Scientific), and positive cells were selected in the presence of 2 μg/ml puromycin. Single cell clones were isolated and screened for Cas9 expression. The SYK knock-out was verified by immunoblotting. Early passage (less than 3) knockout cells were used for experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!