Shp1 c19

Manufactured by Santa Cruz Biotechnology

Sourced in Germany

Shp1 (C19) is a protein-specific antibody produced by Santa Cruz Biotechnology. It is designed to detect Shp1 (also known as PTPN6 or SHP-1) in various sample types.

Automatically generated - may contain errors

Lab products found in correlation

Pdgfr β, by Santa Cruz Biotechnology (1 mentions) Bcl xl h 62, by Santa Cruz Biotechnology (1 mentions) Phospho pdgfr β, by Santa Cruz Biotechnology (1 mentions) Phospho akt, by Santa Cruz Biotechnology (1 mentions)

2 protocols using shp1 c19

Lentiviral Knockdown of SHP1 in HL-60 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Stable knockdown of SHP1 in promyelocytic HL-60 cells was performed by lentiviral transduction of shRNA as described previously (32 (link)) (sequence: CCGGGGAGCATGACACAACCGAATACTCGAGTATTCGGTTGTGTCATGCTCCTTTTTG). The knockdown efficiency was confirmed by Western blot (Shp1 (C19), Santa Cruz Biotechnology, Heidelberg, Germany).
During cell culture, the Shp1 knockdown was maintained by puromycin selection.

Stadtmann A., Block H., Volmering S., Abram C., Sohlbach C., Boras M., Lowell C.A, & Zarbock A. (2015). Crosstalk between Shp1 and PIPKIγ controls leukocyte recruitment.. Journal of immunology (Baltimore, Md. : 1950), 195(3), 1152-1161.

+ Open protocol

+ Expand

Immunoblotting Primary Antibody Optimization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary antibodies for immunoblotting were purchased from commercial sources: actin (horseradish peroxidase; I-19), GAPDH horseradish peroxidase (V18), SHP-1 (C19), PDGF-β (N30), and Bcl-xL (H-62) from Santa Cruz Biotechnology Inc (Dallas, TX); protein kinase B (Akt), phospho-Akt (D9E), phospho-PDGFR-β (Y1009), PDGFR-β, phospho-ERK (extracellular signal-regulated kinase), ERK and secondary antibody of anti-rabbit and anti-mouse

Mercier C., Brazeau T., Lamoureux J., Boisvert E., Robillard S., Breton V., Paré M., Guay A., Lizotte F., Despatis M.A, & Geraldes P. (2021). Diabetes Impaired Ischemia-Induced PDGF (Platelet-Derived Growth Factor) Signaling Actions and Vessel Formation Through the Activation of Scr Homology 2-Containing Phosphatase-1. Arteriosclerosis, thrombosis, and vascular biology, 41(9).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!