Iq5 real time pcr system

Total RNA was extracted from the samples according to our previous report [49 (link)]. The integrity of the RNA was assessed by 1.0% agarose gel electrophoresis. TransScript^®® One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen, Beijing, China) was used for genomic DNA digestion and first-strand cDNA synthesis. The expression analysis of the 12 CsJAZ genes was performed by qRT–PCR using SYBR Premix Ex Taq II kit (Takara, Kusatsu, Japan) with the Bio-Rad IQ5 Real Time PCR System (Bio-Rad, Hercules,CA, USA). The primer pairs used for qRT–PCR are listed in Table S4. Camellia sinensis GAPDH and β-actin were used as an internal control. The qRT–PCR conditions were as follows: 95 °C for 30 s, 40 cycles at 95 °C for 5 s, 60 °C for 30 s. After amplification, the melting curve and amplification curve were checked to evaluate specific amplification. For each gene, all experiments were repeated three times per sample. Relative gene expressions were calculated using the 2^−ΔΔCt method [50 (link)]. The transcripts levels are presented as the mean ± standard error mean (SEM).

qPCR assays were conducted to determine total bacterial biomass using the SYBR Premix Ex TaqTM Kit (Takara, Beijing, China) and iQ5 Real-Time PCR System (Bio–Rad, Hercules, CA, USA). Universal primers Eub338/Eub518 [29 (link)] were used to identify the V4 regions in the bacterial 16S rRNA genes. The PCR mix contained ten microliters each of SYBR green I and ROX dye II (Applied Biosystems, Waltham, MA, USA), 0.4 microliters of each primer, 2.0 microliters of DNA, and sterile deionized water up to a total of twenty microliters. The qPCR conditions entailed initial denaturation at 95 °C for 5 min, followed by 37 cycles of denaturation at 95 °C for 45 s, annealing at 56 °C for 45 s, and a final extension at 72 °C for 2 min. The standard samples were diluted to conduct a set of 10-fold dilutions and then used to quantify gene expression with qPCR. The standard curves were generated according to a predetermined protocol [29 (link)], and the R²-value exceeded 0.99. All amplifications from each individual sample were measured in triplicate.

Cucumber rhizosphere Pseudomonas spp. abundance was estimated with SYBR Green real-time PCR assays with primers of PsF/PsR [37 (link)] on an IQ5 real-time PCR system (Bio-Rad Lab, USA). The PCR protocol was: 95°C for 5 min; followed by 30 cycles of 95°C for 30 s, 65°C for 30 s, 72°C for 90 s; and a final extension at 72°C for 10 min. Standard curves were made with a 10-fold dilution series (10²−10⁸) of plasmids containing 16S rRNA genes from soil samples. Sterile water was used as a negative control to replace the DNA template. All amplifications were done in triplicate. The specificity of the products was confirmed by melting curve analysis and agarose gel electrophoresis. The threshold cycle (Ct) values obtained for each sample were compared with the standard curve to determine the initial copy number of the target gene.

The diluted plasmids containing PCV1 and PCV2 whole genomes were used as templates to draw standard curve. Virus DNA was isolated by proteinase K and SDS to determine the copy numbers of the harvested viruses. The primers were: PCV-F: AGTACCGGGAGTGGTAGGAG; PCV-R: GTTGAATTCTGGCCCTGCTC.
Total cellular RNA was isolated by TRIZOL according to the manufactory's instructions. Reverse transcription was performed using M-MLV reverse transcriptase (Invitrogen) with Random primer. IL-10 mRNA level was analyzed by SYBR-green based Q-PCR using a Bio-Rad IQ5 Real-Time PCR System. IL-10 mRNA were normalized by comparing to β-actin and expressed relative to mock control. Primer sequences were: IL-10-F: AATCTGCTCCAAGGTTCCCG; IL-10-R: TGAACACCATAGGGCACACC; β-actin-F: GGACTTCGAGCAGGAGATGG; β-actin-R: AGGAAG GAGGGCTGGAAGAG.

First-strand cDNA was synthesized as described previously^{18 (link)}. QRT-PCR was performed in the iQ5 Real-time PCR System (Bio-Rad) using iTaq universal SYBR Green supermix (Bio-Rad). Each sample was analyzed in triplicate with GAPDH as the internal control. Supplementary Table S2 lists the primer sequences used for different genes in this study.

Total RNA was extracted from PBMCs using the RNeasy mini kit (Qiagen, Hilden, Germany). RNA concentration and purity were determined by optical density measurement via Nanodrop (Thermo Fisher Scientific, Wilmington, Delaware USA). A mixture of 0.5 ng total RNA per sample was retro-transcribed with random primer-oligodT into complementary DNA (cDNA) using the Quantitect Reverse Transcription Kit (Qiagen, Hilden, Germany). The retro-transcription cycle was performed at 25 °C for 5 min, 42 °C for 30 min and 95 °C for 3 min. RealTime-PCR was carried out in a iQ5 Real Time PCR System and SsoAdvanced Sybr Green Supermix (Bio-Rad Laboratories, Hercules, CA) was employed on the basis of the manufacturer’s conditions: 95 °C, 30s; 40 cycles 95 °C, 5 s, 60 °C, 15 s;a final melting protocol with ramping from 65 °C to 95 °C with 0,5 °C increments of 5 s was performed. The primers sequence for RealTime-PCR were: TF, sense 5’-TTGGCAAGGACTTAATTTATACAC-3’, antisense 5’-CTGTTCGGGAGGGAATCAC-3’; GAPDH, sense: 5’-CCCTTCATTGACCTCAACTACATG-3’ and antisense: 5’-TGGGATTTCCATTGATGACAAGC-3’ (Invitrogen, Monza, Italy). All samples were analysed in duplicate and averaged. The relative expression of the target gene was normalized to the level of GAPDH in the same cDNA.

A portion of the lungs of mice was frozen at −80°C until use for quantitative PCR. Total RNA was extracted by TRIzol (15596026, Invitrogen) following the manufacturer’s instruction and the purity and concentration of the RNA were checked by NanoDrop 2000 Spectrophotometer (Thermo, USA). The reverse transcriptions of 2 μg of RNA were performed with random primers by M-MLV (28025013, Invitrogen) as per the manufacturer’s instruction. Quantitative PCR analyses were performed on the IQ5 real-time PCR System (Bio-Rad) using SYBR Premix Ex Taq II (RR820A, TAKARA) and calculated by 2^−ddCt. 20 ng cDNAs from the lungs were used in the quantitative PCR and the reaction was perform as 95°C 30 s; 95°C 5 s, 60°C 30 s, 40 cycles; 65–95°C, increment 0.5°C. The primers are listed in Table 1.