Sybr green reagent

Manufactured by Takara Bio

Sourced in Japan, United States, China, Germany, Switzerland

SYBR Green is a fluorescent dye that binds to double-stranded DNA. It is commonly used in real-time PCR (qPCR) assays to quantify gene expression or detect specific DNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

212 protocols using sybr green reagent

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was obtained from NP69 and SUNE-1 cells according to the instructions of TRIzol (Invitrogen, USA). 1 μg of RNA was reverse transcribed into cDNA according to the instructions of the PrimeScriptTM RT reagent kit (TaKaRa, Japan) and 1 μg of RNA was reverse transcribed into cDNA according to the instructions of the SYBR Green reagent (TaKaRa, Japan). PCR amplification was performed according to the instructions of the SYBR Green reagent (TaKaRa, Japan). The PCR reaction system was as follows: 1 μL cDNA, 0.5 μL each upstream and downstream primers, 10μL SYBR Premix Ex Taq, 8μL ddH2O. The reaction conditions were: pre-denaturation at 95°C for 7 mins, followed by pre-denaturation at 95°C (5s), 60°C (30s), and 72°C (3 mins). The reaction was performed for 35 cycles at 95°C (5s), 60°C (30s), and 72°C (3 mins). The 2^-ΔΔCT method calculated the relative expression of target genes. The experiments were repeated three times and the mean values were taken. The primers used in this study were listed in Table 1.

Zhou J., Zhang B., Zhang X., Wang C, & Xu Y. (2022). Identification of a 3-miRNA Signature Associated With the Prediction of Prognosis in Nasopharyngeal Carcinoma. Frontiers in Oncology, 11, 823603.

+ Open protocol

+ Expand

Gene Expression Analysis of HO-1, Nrf-2, and NF-κB

Check if the same lab product or an alternative is used in the 5 most similar protocols

Using SYBR Green reagents (Takara), mRNA expression was assessed. The primer sequences used included: HO-1 forward: 5′-TGT GGT ACA GGG AGG CCA TCA CC -3′; HO-1 reverse: 5′-CAG GAT TTG TCA GAG GCC CTG AAG G-3′; Nrf-2 forward: 5′-TCA CCA TCT CAG GGG CAG -3′; Nrf-2 reverse: 5′-CAA CAT ACT GAC ACT CCA ATG C-3′; NF-ĸB forward: 5′-GGA GGC ATG TTC GGT AGT GG-3′; NF-ĸB reverse: 5′-CCC TGC GTT GGA TTT CGT G-3′. And GAPDH forward: 5′-AGGTCGGTGTGAACGGATTTG-3′; GAPDH reverse: 5′-GGGGTCGTTGATGGCAACA-3′. And the expression data was analyzed with Delta Ct.

Ji Q., Ding Y.H., Sun Y., Zhang Y., Gao H.E., Song H.N., Yang M., Liu X.L., Zhang Z.X., Li Y.H, & Gao Y.D. (2016). Antineoplastic effects and mechanisms of micheliolide in acute myelogenous leukemia stem cells. Oncotarget, 7(40), 65012-65023.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated by using RNAiso Plus Reagent (Takara, Japan), and the concentration was measured based on the absorbance ratio of 260 nm/280 nm. Subsequently, 1 μg of total RNA was reverse-transcribed into complementary DNA with a first-strand synthesis kit (Takara, Japan). For each sample, PCR was performed in triplicate with SYBR Green reagents (Takara, Japan) and the LC480 platform (Roche, United States). The expression levels of the target genes were normalized to that of the internal control (GAPDH). The primer sequences were listed in Supplementary Table 1.

Luo D., Yang L., Pang H., Zhao Y., Li K., Rong X, & Guo J. (2022). Tianhuang formula reduces the oxidative stress response of NAFLD by regulating the gut microbiome in mice. Frontiers in Microbiology, 13, 984019.

+ Open protocol

+ Expand

Quantifying miR-455-5p Expression in NSCLC

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were obtained using the TRIzol reagent (Invitrogen). Reverse transcription of RNA was performed using the ImProm-II reverse transcription system (Promega) according to the manufacturer’s instructions.
Quantitative real-time PCR was used to precisely quantify miR-455-5p expression in human NSCLC tissues or cell lines. Quantitative RT-PCR was performed with SYBR Green reagents (Takara, Japan) in a 7500 real-time PCR system from Applied Biosystems. The 2^−ΔΔCT method was used to measure the miR-455-5p gene expression compared with the endogenous controls (U6 non-coding small nuclear RNA). All primers for miR-455-5p and the U6 genes were designed by Primer Premier 5.0 and synthesized by Shanghai GenePharma.

Wang J., Wang Y., Sun D., Bu J., Ren F., Liu B., Zhang S., Xu Z., Pang S, & Xu S. (2017). miR-455-5p promotes cell growth and invasion by targeting SOCO3 in non-small cell lung cancer. Oncotarget, 8(70), 114956-114965.

+ Open protocol

+ Expand

RNA Extraction and RT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from frozen tissues with TRIzol reagent (Invitrogen, Grand Island, NY, USA) and reverse transcribed to complementary DNA (cDNA) by using a PrimeScript™ 1st Strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan) according to the user's manual. Real-time polymerase chain reaction (RT-PCR) was performed with gene-specific primers to determine the relative expression of genes of interest using SYBR green reagents (Takara Bio) in an ABI 7300 sequence detector (Applied Biosystems, Foster City, CA, USA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or ACTIN mRNA was used for normalization. The PCR primers used in this study are listed in Table S1.

Zuo S., Wu L., Wang Y, & Yuan X. (2020). Long Non-coding RNA MEG3 Activated by Vitamin D Suppresses Glycolysis in Colorectal Cancer via Promoting c-Myc Degradation. Frontiers in Oncology, 10, 274.

+ Open protocol

+ Expand

Blood RNA Extraction and qPCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Blood RNA was generated using RNeasy protect animal tubes and blood kit (Qiagen). cDNA was synthesized using Qiagen reagents with random hexamers and oligo(dT) primers. Quantitative PCR was performed using SYBR Green reagents (TaKaRa Bio) on a 7500 fast real-time PCR system (Applied Biosystems). Primers were as in (17 (link)).

Chu T., Ni M., Chen C., Akilesh S, & Hamerman J.A. (2019). BCAP promotes lupus-like disease and TLR-mediated Type I IFN induction in plasmacytoid dendritic cells. Journal of immunology (Baltimore, Md. : 1950), 202(9), 2529-2534.

+ Open protocol

+ Expand

Quantification of KRT17P3 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cultured cells with TRIzol reagent (Invitrogen) according to the manufacturer's protocol. Plasma RNA was extracted using miRNeasy Serum/Plasma Kit (Qiagen, Inc) according to the manufacturer's protocol. cDNA was synthesized with the PrimeScript 1st Strand cDNA Synthesis Kit (Takara Bio) according to the user's manual. RT‐qPCR analysis with gene‐specific primers was performed to determine the relative expression of KRT17P3 using SYBR green reagents (Takara Bio) in an ABI 7300 sequence detector (Applied Biosystems). GAPDH mRNA was used for normalization. The PCR primers used in this study were as follows: KRT17P3, forward: 5’‐ CAGCAGAACCAGCAGTACAAG‐3’ and reverse: 5’‐ TCAGCCACGAAGATGCTTAT‐3’; keratin 17, forward: 5’‐CCAGGATGGCAAGGTCATCTC‐3’ and reverse: 5’‐ GTCATCAGGCAAGGAAGCAT‐3’; and ACTIN, forward: 5’‐TCATGAAGTGTGACGTGGACAT‐3’ and reverse: 5’‐ CTCAGGAGGAGCAATGATCTTG‐3’.

Hou Z., Wang Y., Xia N., Lv T., Yuan X, & Song Y. (2020). Pseudogene KRT17P3 drives cisplatin resistance of human NSCLC cells by modulating miR‐497‐5p/mTOR. Cancer Science, 112(1), 275-286.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was harvested using Trizol reagent (Takara, Japan), and reverse transcription (RT) was performed using Transcript First-strand cDNA Synthesis SuperMix (Roche, Switzerland). The primers used in this study were designed and synthesized by Tsingke Company (Beijing, China) (shown in Supplementary Table S4). The quantitative real-time PCR (qRT-PCR) experiments were performed using SYBR-Green reagents (Takara Bio Inc., Shiga, Japan). GAPDH was used as an internal control. Fold change obtained from Ct values using 2^−ΔΔCt methodology was converted into logarithmic base 2 for statistical analysis. P values < 0.05 were considered statistically significant. Each sample was run in triplicate, and the control group was set as 1.

Zhang M., Peng Y., Yang Z., Zhang H., Xu C., Liu L., Zhao Q., Wu J., Wang H, & Liu J. (2022). DAB2IP down-regulates HSP90AA1 to inhibit the malignant biological behaviors of colorectal cancer. BMC Cancer, 22, 561.

+ Open protocol

+ Expand

Quantifying FGF2 and miR-152 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using TRIzol (Invitrogen) according to the manufacturer's protocol. FGF2 expression was detected with SYBR Green reagents (TAKARA, Tokyo, Japan) using the following primers: 5′-AGGAGAGCGACCCACACATCAA-3′ (forward) and 5′-AGCCAGCAGTCTTCCATCTTCC-3′ (reverse). MiRNA was extracted using an All-in-One microRNA extraction kit and detected with an All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Carlsbad, CA, USA) using SYBR Green reagents. Primers for miR-152 (Cat No. HmiRQP3058) and U6 (HmiRQP9001) were purchased from GeneCopoeia. FGF2 expression was normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and miR-152 was normalized to U6. Expression levels were quantified using the 2^−ΔΔCt method.

Cheng Z., Ma R., Tan W, & Zhang L. (2014). MiR-152 suppresses the proliferation and invasion of NSCLC cells by inhibiting FGF2. Experimental & Molecular Medicine, 46(9), e112-.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol reagent (Gibco, USA) in accordance with the manufacturer’s instructions and then reverse transcribed using a Prime-Script RT Reagent Kit (TaKaRa, Japan). Quantitative PCR was conducted using an ABI 7500 Real-Time PCR system (Life Tech, USA) using SYBR Green Reagents (TaKaRa, Japan). In addition, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used to normalize the gene expression levels. Subsequently, the relative gene expression levels were calculated using the threshold cycle (CT) method (2−^△△CT method). All the primers used for real-time PCR are listed in Supplementary Table 1.

Zhuang B.M., Cao D.D., Liu X.F., Wang L., Lin X.L., Duan Y.G., Lee C.L., Chiu P.C., Yeung W.S, & Yao Y.Q. (2023). Application of a JEG-3 organoid model to study HLA-G function in the trophoblast. Frontiers in Immunology, 14, 1130308.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!