Total RNAs were obtained from tissues and cell lines using Trizol reagent (Invitrogen). RNAs were transcribed into cDNA using Prime-Script RT Reagent Kit (Takara, Dalian, China). qPCR was carried out using SYBR Prime Script RT-PCR kits (Takara) on ABI 7300 Fast Real-Time PCR system m (Applied Biosystems, Foster City, CA) following the manufacturer’s protocols. U6 was as a normalized control for miRNA and GAPDH was used as normalized control for other genes. Relative expression was calculated using the 2−ΔΔCt method. The primer sequences were as follows: LINC01494 (Forward: 5ʹ-CCCGACCTTAGAGTTCTGCG-3ʹ, reverse: 5ʹ-CCCCCAGGAGAGGGTAAGAT-3ʹ), CCNG1 (Forward: 5ʹ-GTTACCGCTGAGGAGCTGCAGTC-3ʹ, reverse: 5ʹ-GCAGCCATCCTGGATGGATTCAG-3ʹ) and miR-122-5p (Forward: 5ʹ-GTGACAATGGTGGAATGTGG-3ʹ, reverse: 5ʹ-AAAGCAAACGATGCCAAGAC-3ʹ), U6 (Forward: 5ʹ-CTCGCTTCGGCAGCACA-3ʹ, reverse: 5ʹ-AACGCTTCACGAATTTGCGT-3ʹ) and GAPDH (Forward: 5ʹ-AGCCACATCGCTCAGACA-3ʹ, reverse: 5ʹTGGACTCCACGACGTACT-3ʹ).
Sybr prime script rt pcr kits
Manufactured by Takara Bio
Sourced in Japan, China
The SYBR Prime Script RT-PCR Kits are a set of reagents designed for reverse transcription and real-time PCR (RT-PCR) analysis. The kits include all the necessary components for performing cDNA synthesis and subsequent gene expression quantification using SYBR Green detection chemistry.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (22 mentions)
Primescript rt reagent kit, by Takara Bio (20 mentions)
Trizol reagent, by Takara Bio (4 mentions)
Rnaiso plus reagent, by Takara Bio (2 mentions)
Superscript 2, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Elisa assay kit, by Merck Group (1 mentions)
Stratagene mx3005p qpcr system, by Agilent Technologies (1 mentions)
Primescript rt reagent kit, by Bio-Rad (1 mentions)
Abi prism 7900 real time system, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Qiagen (1 mentions)
M mlv reverse transcriptase, by Takara Bio (1 mentions)
M mlv reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
Taqman mirna assay kit, by Thermo Fisher Scientific (1 mentions)
Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase kit, by Promega (1 mentions)
Lightcycler 480 system, by Roche (1 mentions)
Prime script reagent rt kit, by Takara Bio (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
32 protocols using sybr prime script rt pcr kits
1
Quantitative Analysis of Gene Expression
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by using TRIzol reagent (Invitrogen) according to the manufacturer’s guidance. A PrimeScript RT reagent kit (Takara, Dalian, China) was used to carry out reverse transcription in accordance with the manufacturer’s instructions. SYBR Prime Script RT-PCR kits (Takara) were used to perform qRT-PCR on the basis of the manufacturer’s protocols. All mRNA expression levels were calculated by using the 2−ΔΔCt method and were normalized to GAPDH or U6 expression. All assays were carried out independently three times. The PCR primers are listed in Table S1 .
3
Extraction and Quantification of lncRNA and miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the glioma tissues and normal brain tissues or cultured cells using TRIzol reagent (Invitrogen, Carlsbad, CA) following the manufacturer's instructions. RNA quality and concentration were evaluated by a Nanodrop 2000 (Thermo Fisher Scientific, Wilmington, DE). Total RNA was reverse‐transcribed into cDNA using Prime‐Script RT Reagent Kit (Takara, Dalian, China). Quantitative real‐time polymerase chain reaction (qRT‐PCR) was performed with SYBR Prime Script RT‐PCR kits (Takara) on ABI 7500 Fast Real‐Time PCR system m (Applied Biosystems, Foster City, CA) based on the manufacturer's instructions. The sequences of primers (BGI, Shenzhen, China) used in this study were: LINC00460, 5′‐AATGGTGGTAGGAGGGAGGA‐3′ (forward) and 5′‐CAAGGGGAATGAACACGAGG‐3′ (reverse); GAPDH, 5′‐GGGAGCCAAAAGGGTCA‐3′ (forward), 5′‐GAGTCCTTCCACGATACCAA‐3′(reverse); miR‐320a, 5′‐GGGCTAAAAGCTGGGTTGA‐3′ (forward) and 5′‐CAGTGCGTGTCGTGGAGT‐3′ (reverse). U6 5′‐GCTTCGGCAGCACATATACT‐3′ (forward), and 5′‐GTGCAGGGTCCGAGGTATTC‐3′ (reverse). GAPDH and U6 were used as internal control to detect lncRNA and miRNA, respectively. The 2−ΔΔCt method was used to detect the gene relative expression level.
4
Evaluating Anti-inflammatory Effect of IL-10-hAMSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate the anti-inflammatory effect of IL-10-hAMSCs, skin around wounds was collected at 3, 7, and 14 d after treatment, and inflammatory cell infiltration was observed by hematoxylin and eosin (H&E) staining. Expression levels of inflammatory factors IL-10, tumor necrosis factor-α (TNF-α), and IL-6 were quantitatively assayed with an ELISA assay kit (Sigma-Aldrich) following the manufacturer's instructions. The real-time fluorescence quantification polymerase chain reaction (qPCR) was used to detect relative mRNA levels for IL-10, TNF-α, and IL-6. For qPCR, total RNA was extracted from tissue around wounds using the RNAiso Plus reagent (Takara, Dalian, China); cDNA was synthesized from 2 μg total RNA with SYBR PrimeScript RT-PCR Kits (Takara), and qPCR was carried out using SYBR PrimeScript RT-PCR Kits on a Stratagene MX3005P qPCR system (Agilent Technologies, Santa Clara, CA, USA). All steps were performed according to the manufacturer's protocol. Fold change of each target gene was normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA.
5
Quantifying lncRNA and miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells was isolated by using Trizol reagent (Invitrogen, Carlsbad, CA, USA). Real-time PCR was performed with SYBR Prime Script RT-PCR Kits (Takara, Japan) based on the manufacturer’s instructions. The LINC-ROR, FOXM1, miR-129-5p, miR-153-3p, miR-152-3p, miR-876-5p, miR-214-3p, and miR-185-5p levels were detected with the 2−ΔΔCt method. GAPDH mRNA was employed as an endogenous control for mRNA and lncRNA, and U6 RNA was used as a miRNA internal control. For exact quantification of gene copies per cell, LINC-ROR and reverse-transcribed miR-145 cDNA were used as standard templates to formulate standard curves with limit dilution approaches. PCR primers are listed in Table S2 .
6
Quantification of linc-ROR, miR-145, and FSCN1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from tissues and cells was isolated with Trizol reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Reverse transcription was performed with PrimeScript RT reagent Kit (Takara, Japan) according to the manufacturer's protocol. qRT-PCR was performed with SYBR Prime Script RT-PCR Kits (Takara, Japan) based on the manufacturer's instructions. The linc-ROR, miR-145 and FSCN1 level was calculated with the 2ΔΔCt method, which were normalized to GAPDH mRNA or U6 rRNA, respectively. All assays were performed in triplicate. The expression levels were relative to the fold change of the corresponding controls which were defined as 1.0. PCR primers were designed as follows:
lincROR forward:5′- GAATCAGAGTGCTG GGCAGT-3′, and reverse: 5′-TCAGCAGCTCATGCC CTAAC-3′; GAPDH: forward, 5′-CTGGGCTACACTGA GCACC-3′, and reverse: 5′- AAGTGGTCGTTGAG GGCAATG-3′; miR-145: forward: 5′-GTCCAGTTTTCCC AGGAATCCCT-3′ and reverse: 5′-GCTGTCAACGATA CGCTACCTA-3′; U6 forward: 5′-CGCTTCGGCAGCAC ATATACTA-3′ and reverse: 5 ’-CGCTTCACGAATTT GCGTGTCA-3′; FSCN1: forward: 5′-CCA GGG TAT GGA CCT GTCTG-3′, and reverse: 5′-GTG TGG GTA CGG AAG GCAC-3′.
lincROR forward:5′- GAATCAGAGTGCTG GGCAGT-3′, and reverse: 5′-TCAGCAGCTCATGCC CTAAC-3′; GAPDH: forward, 5′-CTGGGCTACACTGA GCACC-3′, and reverse: 5′- AAGTGGTCGTTGAG GGCAATG-3′; miR-145: forward: 5′-GTCCAGTTTTCCC AGGAATCCCT-3′ and reverse: 5′-GCTGTCAACGATA CGCTACCTA-3′; U6 forward: 5′-CGCTTCGGCAGCAC ATATACTA-3′ and reverse: 5 ’-CGCTTCACGAATTT GCGTGTCA-3′; FSCN1: forward: 5′-CCA GGG TAT GGA CCT GTCTG-3′, and reverse: 5′-GTG TGG GTA CGG AAG GCAC-3′.
7
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the treated splenocytes was extracted using TRIzol reagent (Qiagen, Hilden, Germany) and quantified using the Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). For the detection of mRNA, 2 μg of total RNA was reversely transcribed into cDNA using PrimeScript RT reagent Kit (Bio-Rad, Hercules, CA, USA). Subsequently, RT-PCR was performed with SYBR Prime Script RT-PCR Kits (TaKaRa, Otsu, Shiga, Japan) on an ABI PRISM 7900 Real-Time system (Applied Biosystems, Foster City, CA, USA), with GAPDH as an endogenous control. The reaction protocol was as follows: denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation 95 °C for 30 s, annealing at 60 °C for 1 min and extending at 72 °C for 30 s. The relative gene expression was calculated using the 2−∆∆Ct method.
8
Quantifying miR-324-3p, MALAT1, and ADAM17 in Oxaliplatin-Resistant CRC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA from tumor Ox-resistant CRC tissues and cells was extracted with Trizol reagent (Invitrogen). The total RNA was reversely transcribed into complementary DNA (cDNA) utilizing PrimeScript RT reagent Kit (Takara, Dalian, China). Then, qRT-PCR was carried out with the synthesized cDNA, corresponding primers, and the reagent of SYBR Prime Script RT-PCR Kits (Takara). The levels were calculated using the 2−ΔΔCt method. U6 small nuclear 1 (U6, Gene ID: 26827) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, GeneID: 2597) were used to standardize the expression of miR-324-3p (Gene ID: 442898), MALAT1 (GeneID: 378938) and ADAM17 (GeneID: 6868). The primers were as listed: MALAT1 (Forward: 5′-GGGTGTTTACGTAGACCAGAACC-3′, Reverse: 5′-CTTCCAAAAGCCTTCTGCCTTAG-3′); miR-324-3p (Forward: 5′-ACTGCCCCAGGTGCTGCTGG-3′, Reverse: 5′-TGTCAAAAGGGAAATGAGGC-3′); ADAM17 (Forward: 5′-GTGCAGGGTCCGAGGT-3′, Reverse: 5′-GCGAGCACAGAATTAATACGAC-3′); GAPDH (Forward: 5′-GCACCGTCAAGGCTGAGAAC-3′, Reverse: 5′-ATGGTGGTGAAGACGCCAGT-3′); U6 (Forward: 5′-CTCGCTTCGGCAGCACA-3′, Reverse: 5′-AACGCTTCACGAATTTGCGT-3′).
9
Quantification of miR-570-3p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from BC cells using RNAiso Plus reagent (Takara, Dalian, China). To detect the expression of miR-570–3p, total RNA was reversely transcribed using MMLV reverse transcriptase (Takara, Dalian, China). The obtained cDNA was then used as the template for RT-PCR with SYBR Prime Script RT-PCR Kits (Takara, Dalian, China). The quantitative results were calculated after the reaction with 2 −ΔΔCt method, and the detailed information of the primer sequences was shown in Table 1 .Table 1
qRT-PCR Primer Sequence (5′–3′).
| Name | Primer Sequences |
|---|---|
| lncRNA MALAT1 | Forward: 5′-GAAGATAGGCATTTGAGTGGCT-3′ |
| Reverse: 5′-CTGAAGAGCATTGGAGATCAGC-3′ | |
| miR-570–3p | Forward: 5′-ACACTCCAGCTGGGCGAAAACAGCA-3′ |
| Reverse: 5′-CGGCAATTCAGTTGAGGCAAAGGT-3′ | |
| U6 | Forward: 5′-GCTTCGGCAGCACATATACT-3′ |
| Reverse: 5′-ACGCTTCACGAATTTGCGTG-3′ | |
| β-actin | Forward: 5′-ACTCGTCATACTCCTGCT-3′ |
| Reverse: 5′-GAAACTACCTTCAACTCC-3′ |
10
Quantitative Analysis of let-7c and E2F5 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from tissues and cells was isolated with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Reverse transcription was performed with PrimeScript RT Reagent Kit (Takara, Dalian, P.R. China) according to the manufacturer’s protocol. qRT-PCR was performed with SYBR Prime Script RT-PCR Kits (Takara) based on the manufacturer’s instructions. The expression levels of let-7c and E2F5 were calculated with the 2−ΔΔCt method, which were normalized to U6 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA, respectively. All assays were performed in triplicate. The expression levels were relative to the fold change of the corresponding controls, which were defined as 1.0.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!