The largest database of trusted experimental protocols

Lipofectamine tm 3000 reagent

Manufactured by GenePharma
Sourced in China

Lipofectamine TM 3000 reagent is a lipid-based transfection reagent used for the delivery of nucleic acids, such as DNA and RNA, into eukaryotic cells. It facilitates the uptake of genetic material into the cells, enabling researchers to study gene expression and function.

Automatically generated - may contain errors

2 protocols using lipofectamine tm 3000 reagent

1

Knockdown of ALKBH5, YAP, YTHDF1, YTHDF2, and miR-181b-5p

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were transfected to knockdown the expression of ALKBH5, YAP, YTHDF1, YTHDF2, and miR-181b-5p using Lipofectamine TM 3000 Transfection Reagent (Cat# L3000-015; Invitrogen, California, USA) according to the manufacturer’s instructions. Briefly, 2 × 105 cells were seed in a 6-well plate and they will be 70% confluent at the time of transfection. 6 μL Lipofectamine TM 3000 reagent and 40 nM siRNA (Gene Pharma, Shanghai, China) were diluted in 125 μL Opti-MEM (Cat# 31985-070; gibco, Grand Island, USA) medium respectively. After Mix and incubation for 2 min separately, these two regents were then mixed and incubated for another 10 min and then added it to cells. Subsequent experimental measurements were performed 24 h after transfection. The siRNAs and miR-181b-5p inhibitor sequence used are as following: ALKBH5siRNA:5CUGCGCAACAAGUACUUCUTT3 YAPsiRNA:5GGUGAUACUAUCAACCAAATT3 YTHDF1siRNA:5CCUGCUCUUCAGCGUCAAUTT3 YTHDF2siRNA:5AAGGACGUUCCCAAUAGCCAATT3 miR181b5pinhibitorAMO:5ACCCACCGACAGCAAUGAAUGUU3
+ Open protocol
+ Expand
2

Knockdown and Overexpression of METTL1 and miR-26a-5p

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were transfected to knock down the expression of METTL1 and AMO-miR-26a-5p using Lipofectamine TM 3000 Transfection Reagent (Cat# L3000-015; Invitrogen, California, USA). METTL1, FTH1, FTH1-mut plasmid and miR-26a-5p mimic were purchased from Gene Pharma (China) to increase the expression of the plasmid. Brie y, for siRNAs, 2 × 10 5 cells were seeded in a 6-well plate and they will be 70% con uent at the time of transfection 6 µL Lipofectamine TM 3000 reagent and 20 nM siRNA (Gene Pharma, Shanghai, China) were diluted in 125 µL Opti-MEM (Cat# 31985-070; gibco, Grand Island, USA) medium respectively. After Mix and incubating for 2 min separately, these two regents were then mixed and incubated for another 10 min and then added to cells. For plasmids, cells were transfected with 500 ng plasmid using Lipofectamine TM 3000 Transfection Reagent according to the manufacturers' protocols. Subsequent experimental measurements were performed 24 h after transfection.
The sequences used are as following: METTL1 siRNA sense: 5'-CCAAAGGAUAAGAAAGAAATT-3' METTL1 siRNA antisense: 5'-UUUCUUUCUUAUCCUUUGGTT-3' AMO-MiR-26a-5p: 5'-AGCCUAUCCUGGAUUACUUGAA-3' hsa-miR-26a-5p mimics sense: 5'-UUCAAGUAAUCCAGGAUAGGCU-3' hsa-miR-26a-5p mimics antisense: 5'-AGCCUAUCCUGGAUUACUUGAA-3'
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!