Epigallocatechin

Standards of (+)‐catechin (C), (−)‐epicatechin (EC), (−)‐epigallocatechin (EGC), (−)‐epicatechin 3‐O‐gallate (ECG), (−)‐epigallocatechin 3‐O‐gallate (EGCG), gallic acid (GA), and caffeine were purchased from Sigma‐Aldrich Co. Ltd. SP fungal DNA Kit, DNA marker, polymerase chain reaction (PCR) spread reagent, and PCR primers, ITS1 (5′‐TCCGTAGGTGAACCTGCGG‐3′) and ITS4 (5′‐TCCTCCGCTTATTGATAGC‐3′); Bt2a (5′‐GGTAACCAAATCGGTGCTGCTTTC‐3′) and Bt2b (5′‐ACCCTCAGTGTAGTGACCCTTGGC‐3′); and CF1L (5′‐GCTGACTCGTTGACCGAAGAG‐3′) and CF4 (5′‐ATTTTTGCATCATGAGCTGAAC‐3′), were purchased from TaKaRa Biotechnology Co. Ltd. Acetonitrile, methanol, and acetic acid for high‐performance liquid chromatography (HPLC) were purchased from Mreda Biotechnology Co. Ltd.

The HPLC analytical-grade hexane, acetone, acetonitrile, ethyl acetate, methanol and analytical grade 2,2-diphenyl-1-picrylhydrazyl (DPPH), 6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox), hydrochloric acid, citric acid, sodium hydroxide, sodium chloride, aluminum chloride, ethanol, Folin–Ciocâlteu reagent, gallic acid, inulin were purchased by Sigma Aldrich (Darmstadt, Germany). For cromatographic analysis the following reagents were used: HCl ACS reagent (37%), acetic acid, methanol, ethyl acetate, acetonitrile, theaflavin, cafestol, procyanidin A1, procyanidin B1, (−)-epigallocatechin, catechin, caffeine, caffeic acid, ellagic acid, gallic acid, protocatechuic acid, trans-cinnamic acid, quercetin 3-glucoside, quercetin 3-D-galactoside, quercetin 3-β-D-glucoside, naringin, hesperidin, myricetin, apigenin, kaempferol, luteolin, and isorhamnetin (HPLC-grade), purchased from Sigma-Aldrich (Darmstadt, Germany). Other reagents such as sodium bicarbonate were purchased from Honeywell, Fluka (Seelze, Germany). The Lo. bifermentans MIUG BL 16 strain was from Microorganism Collection of Dunarea de Jos University (acronym MIUG, Galati, Romania). de Man, Rogosa and Sharpe agar (MRS agar) was purchased from Merck (Darmstadt, Germany).

Trifluoracetic acid, acetonitrile, methanol, and ethanol were provided from Penta (Prague, Czech Republic). α-Amylase and neutral detergent solution package (containing sodium lauryl sulphate, EDTA disodium, sodium borate, sodium phosphate dibasic together with triethylene glycol) were purchased from Ankom Technology (Macedon, NY, USA). Folin-Ciocalteu reagent, AlCl₃·6H₂O were purchased from Penta (Prague, Czech Republic). The substance 2,2’-azinobis(3-ethylbenzo-thiazoline-6-sulfonic acid) diammonium salt (ABTS), radical 2,2-diphenyl-1-picrylhydrazyl (DPPH), and standard 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (trolox) were provided from Sigma-Aldrich (St. Louis, MI, USA). Phenolic and sugar standards were as follows: Epigallocatechin, catechin, epicatechin, rutin, quercetin, kaempferol, neochlorogenic, chlorogenic, gallic, protocatechuic, p‑hydroxybenzoic, vanillic, caffeic, syringic, p-coumaric, ferulic, sinapic, ellagic, o-coumaric, cinnamic acids and protocatechuic acid ethyl ester; D(+)-maltose, D(+)-glucose, D(−)-fructose, D(+)-rhamnose, D(+)-xylose, D(+)-saccharose, all were purchased from Sigma-Aldrich (St. Louis, MI, USA). All standards and solvents used in this study were of HPLC-grade (purity ≥ 98.5–99.0%). Total dietary fiber and resistant starch assay kits were provided from Megazyme International Ireland Ltd. (Wicklow, Ireland).