The largest database of trusted experimental protocols

6 protocols using lenti pac hiv mix

1

Knockdown and Overexpression of HCC Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human HCC cell lines (PLC-8024, Huh7, Hep3B, MHCC-97H and HepG2) and MIHA normal liver cells were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences (Shanghai, China) with short tandem repeat appraisal certificates. All cells were cultured as described previously.21 (link) Huh7 and MHCC-97H cells were infected with lentiviral pLKO.1 particles containing short hairpin RNA (shRNA) and were selected with 3 mg/mL puromycin (ThermoFisher, Waltham, MA, USA) for 4 days. Lentiviral pLKO.1 plasmids for shPLOD2 (Jidan, Guangzhou, China) were packaged with Lenti-Pac HIV mix (GeneCopoeia, Guangzhou, China) and Endo-Fectin Lenti (GeneCopoeia, Guangzhou, China) in 293T cells to produce lentiviral particles. For BIRC3 overexpression experiment, the BIRC3 expression plasmid (Jidan, Guangzhou, China) was packaged with Lipofectamine 2000 (ThermoFisher, Waltham, MA, USA) and then infected PLOD2 knockdown (KD) Huh7 and MHCC-97H cells.
+ Open protocol
+ Expand
2

Establishing CFH Knockdown HCC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The non‐metastatic HCC Huh7 and metastatic HCC MHCC97L cell lines were used to establish non‐target control (CTL‐KD) and CFH knockdown stable clones (CFH‐KD1 and CFH‐KD2) using MISSION non‐target shRNA control vector and two different shRNA targeting sequences of CFH (Sigma‐Aldrich), sh‐57134 (5′‐CCGGGCCAGTAATGTAACATGCATTCTCGAGAATGCATGTTACATTACTGGCTTTTTG‐3′) and sh‐371774 (5′‐CCGGTACTCACCTTTAAGGATTAAACTCGAGTTTAATCCTTAAAGGTGAGTATTTTTG‐3′), respectively. 293FT cells were co‐transfected with shRNA, Lenti‐Pac HIV mix (GeneCopoeia Inc.) and EndoFectin Lenti transfection reagent (GeneCopoeia Inc.). The viral supernatant was collected and used to transduce HCC cells. The transduced cells were selected by puromycin (Merck). The CFH expression of the resistant clones was examined by western blotting.
+ Open protocol
+ Expand
3

Lentiviral Assembly Using GeneCopeia Kit

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral assembly was accomplished using the GeneCopeia Lenti-Pac HIV Expression Packaging Kit (cat# HPK-LvTR-20). Two days prior to lentiviral transfection HEK293T cells were plated onto a 10 cm dish at 1.5 million cells and cultured in 10 mL DMEM supplemented with 10% heat inactivated FBS. 48 h after plating, cells were 70–80% confluent and transfected with 15 μL of EndoFectin and a mix of 2.5 μg of pKLV-U6Barcode-gRNA-PGKpuro2ABFP and 2.5 μg of Lenti-Pac HIV mix (GeneCopoeia). The media was replaced 14 h post transfection with 10 mL DMEM supplemented with 5% heat inactivated FBS and 20 μL TiterBoost (GeneCopoeia) reagent. Media containing viral particles was collected at 48 and 72 h post transfection, centrifuged at 500g for 5 min, and filtered through a 45 μm poly(ether sulfone) (PES) low protein-binding filter. Filtered supernatant was stored at –80 °C in aliquots for later use.
+ Open protocol
+ Expand
4

Lentiviral C-Myb Overexpression in HEK 293Ta Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK 293Ta cells were cotransfected with 2.5 µg lentiviral C-Myb (GeneCopoeia, USA) plasmids, 5 µL Lenti-Pac HIV mix, and 15 µL EndoFectinLenti following the manufacturer's protocols (GeneCopoeia, USA). After 48 h of transfection, particles were collected from cell medium by 10 min centrifugation at 500 g and 0.44 µm filtration. To increase the transfection efficiency, virus-containing filtrate, mixed with isometric serum-free medium containing 20 µg/mL polybrene (Sigma, USA), was added to cells overnight and replaced with regular culture medium for subsequent 24 h incubation. Finally, cells used for follow-up experiments were selected by 10 µg/mL puromycin (Sigma, USA) for 48 h.
+ Open protocol
+ Expand
5

Establishing Stable IRF6 Knockdown and Overexpression Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentivirus-expressing IRF6 shRNA were produced to structure stable IRF6 knockdown cell lines. Two more effective shRNA sequences (shRNA plasmid DNAs purchased from Obio Technology; the TRC numbers for the IRF6 sh1 and sh2 plasmids are Y3667 and Y3668, respectively) were selected for the following research. Lentiviruses were generated by 293T cells with the shRNA using the X-tremeGENE HP DNA transfection reagent (Roche). Forty-eight hours after transfection, the harvested infectious lentiviruses were filtered through a 0.45 µm filter (Millipore, GLQ025), transduced with lentiviruses IRF6 shRNA and control shRNA, and selected with 2 μg/mL puromycin (SIGMA, A1113803) for 5–7 days. The efficiency of the IRF6 knockdown was analyzed using real-time PCR and immunoblotting.
Lentiviral plasmids were co-transfected with Lenti-pac HIV mix (Genecopoeia, LT003) and EndoFection mix (Genecopoeia, LT003) into 293T cells to establish the IRF6 stable overexpression MDA-MB-231 cell line. A homologous vector carrying a Flag sequence was used as the control. Cells were transfected with lentiviruses IRF6 or vector. Stable cell lines were selected in 2 μg/mL puromycin for 5–7 days and the IRF6 overexpression efficiency was confirmed by RT-qPCR and immunoblotting.
+ Open protocol
+ Expand
6

Lentiviral Vector Production in HEK293T

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral assembly was performed using the Lenti-Pac HIV Expression Packaging Kit (GeneCopeia). Two days prior to lentiviral transfection 1.5 million HEK293T cells were plated in a 10 cm tissue culture dish. Forty eight hours after plating, cells were 70-80% confluent and transfected with 9 µL of Lipofectamine 2000 (Thermo Fisher #11668027), 1.5 µg per well of PsPax2 (Addgene #12260), 0.4 µg/well of VSV-G (Addgene #8454), and 2.5 μg of Lenti-Pac HIV mix (GeneCopoeia). Media was replaced 24 hours post transfection with 10 mL DMEM supplemented with 5% heat inactivated FBS and 20 μL TiterBoost (GeneCopoeia) reagent. Media containing viral particles was collected at 48 and 72 hours post transfection, centrifuged at 500g for 5 minutes, and filtered through a 45 μm poly(ether sulfone) (PES) low protein binding filter. Filtered supernatant was stored at -80 °C in aliquots for later use.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!