Lightcycler 2.0 real time pcr system

Total RNA was extracted using TRIzol Reagent (Thermo Fisher Scientific, MA, USA), and the concentration and purity of total RNA were determined by an ultraviolet spectrophotometer (Eppendorf, Hamburg, Germany). Nuclear and cytoplasmic RNA isolation was performed using a PARIS Kit (Invitrogen, Carlsbad, MA, USA) following the manufacturer’s instructions. PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara, Tokyo, Japan) was used to reverse transcribe RNA to cDNA. Real-time PCR was implemented using SYBR Premix Ex Taq (Takara, Tokyo, Japan) on a LightCycler® 2.0 Real-time PCR System (Roche, Basel, Switzerland). GAPDH was used as an internal reference gene. The results were analysed by the 2-ΔΔCt method. All primer sequences are listed in Additional file 1: Table S1.

TRIzol Reagent (Invitrogen, Waltham, MA, USA) was used to extract the total RNA from cells and tissues, and the concentration and purity of the total RNA were detected by an ultraviolet spectrophotometer (Eppendorf, Germany). The RNA was reverse transcribed into cDNA with PrimeScript^TM RT Reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Japan). Real-time PCR was conducted using SYBR Premix Ex Taq System (Takara), using LightCycler® 2.0 Real-time PCR System (Roche, USA). The results were determined using the 2^−ΔΔCt method. The primer sequences of eIF3b were as follows: 5′-CGGTGCCTTAGCGTTTGTG-3′ (forward) and 5′-CGGTCCTTGTTGTTCTTCTGC-3′ (reverse); the primer sequences of GAPDH were 5′-TGACTTCAACAGCGACACCCA-3′ (forward) and 5′-CACCCTGTTGCTGTAGCCAAA -3′ (reverse).

Small RNA was extracted from samples using RNAiso Kit for Small RNA (TaKaRa, Dalian, China) and subsequently reverse transcribed into cDNA by One Step PrimeScript miRNA cDNA Synthesis Kit (TaKaRa). Meanwhile, total RNA from samples was extracted using Ultrapure RNA Kit (KangWei, Beijing, China) and transcribed into cDNA using PrimeScript RT reagent Kit (TaKaRa). The sequences of PCR primers were shown in Supplementary Table 1. The quantitative PCR was performed using SYBR Premix Ex Taq (TaKaRa) and a LightCycler 2.0 Real Time PCR system (Roche Diagnostics, Rotkreuz, Switzerland). U6 and β-actin were used for normalizing the expression of miRNA and mRNA, respectively. The experiments were performed in triplicate.

Bacterial composition of total bacterial load and selected members of the GM were enumerated at the beginning t = 0 h) and after 24 h of fermentation by real-time quantitative PCR (qPCR) as previously described [21 (link)]. For gut microbiota analysis, we have selected bacteria with previously reported alterations in autism spectrum disorders [16 (link),27 (link)]. Quantitative polymerase chain reaction based on SYBR Green I was performed on a LightCycler^® 2.0 Real-Time PCR System (Roche Diagnostics GmbH, Mannheim, Germany) using the KAPA SYBR^® Fast Master Mix (2×) Universal Kit (Kapa Biosystems Inc., Wilmington, MA, USA) (Table 2) [21 (link)]. PCR reactions were performed in duplicate, in LightCycler^® glass capillaries, and contained 10 ng of each faecal DNA preparation (2 ng ΜL⁻¹), 10 μL of KAPA kit, 200 nM of each primer, 0.25 μL of Bovine Serum Albumin (BSA 20 mg mL⁻¹, New England Biolabs Inc, Hitchin, UK), and 3.95 μL ddH₂O. The thermal cycling conditions consisted of 3 min at 95 °C, followed by 45 cycles of 3 s at 95 °C, and then 20 s at 72 °C. Primer specificity was verified by performing a melting curve analysis. Microbial quantification was based on standard curves of genomic DNA from reference strains with the LightCycler^® software version 4.1 (Roche Diagnostics GmbH). Data are expressed as log₁₀ copies of 16S rRNA gene mL⁻¹ of sample [21 (link)].

The total RNA was isolated independently three times from control Vero 023 and Vero A3G cells using the GeneElute Mammalian Total RNA kit (Sigma) as per the manufacturer’s instructions. Isolated RNA was reverse transcribed in cDNA using the RevertAid first strand cDNA synthesis kit (Fermentas). Gene specific primers were used to amplify the target genes. Real time PCRs were performed using the 2X SYBR Green qPCR Master mix (Bimake, Houston, TX, USA ) and amplified on the LightCycler 2.0 real-time PCR system (Roche, Basel, Switzerland). Primers for KDELR2 were forward: 5′ CTCTTCCTCTGCTGCGAAGT 3′ and reverse: 5′ ATGGAAAGCAGCCAAAACTC 3′. Cycling conditions were as follows: 95 °C for 180 s, followed by 45 cycles of 95 °C 10 s, 60 °C for 30 s, followed by 95 °C for 10 s, 60 °C for 60 s, 95 °C for 1 s, followed by 37 °C for 30 s. A melting curve analysis was performed after each run to verify single PCR products. The relative copy number was calculated using the ∆∆Ct method.