The largest database of trusted experimental protocols

10 protocols using rt qpcr primers

1

Notch Signaling Pathway Regulation in Activated Mouse PaSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from non-activated and activated mouse PaSCs 48 h after transfection with either Notch3 siRNA or control siRNA using TRIzol reagent (Invitrogen, Chicago, USA). The RNA concentration was measured using a NanoDrop® ND-1000 Spectrophotometer (Wilmington, DE). cDNA was synthesized with a RevertAid first strand cDNA synthesis kit (k1622, Thermo Scientific, Waltham, USA). RT-qPCR primers were synthesized by Sangong Biotech (Shanghai) and are listed in Table 2. RT-qPCR was conducted using a Mx3000p RT-PCR detection system and TransStart Top Green qPCR SuperMix (AQ131–02, Transgen Biotech, Beijing, China). The relative gene expression levels were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) levels.

Primers used for RT-qPCR

PrimerForward sequence 5′-3’Reverse sequence 5′-3’
Notch1TCGTGCTCCTGTTCTTTGTGCTCTCCGCTTCTTCTTGCTG
Notch2GCAGGAGCAGGAGGTGATAGATGAGAAGCCAGGAGAGCAG
Notch3TGGCTATGCTGGTGACAGTTAGGGGGACAGGAACAGAGAT
Notch4AATGCCAAGGTCAGGAACACAGCCCTCATCACACACACAC
α-SMAAATGGCTCTGGGCTCTGTAACTCTTGCTCTGGGCTTCATC
FibronectinGAAGTCGCAAGGAAACAAGCGTAGGTGAACGGGAGGACAC
CollagenITGACTGGAAGAGCGGAGAGTGACGGCTGAGTAGGGAACAC
HES1GGCGAAGGGCAAGAATAAATTGCTTCACAGTCATTTCCAGA
GAPDHGGTTGTCTCCTGCGACTTCATGGTCCAGGGTTTCTTACTCC
+ Open protocol
+ Expand
2

Irisin Modulates Inflammation and Metabolic Responses

Check if the same lab product or an alternative is used in the 5 most similar protocols
Irisin was purchased from Cayman Chemical Company. LPS (Escherichia coli 0111: B4) was purchased from MilliporeSigma. MCC950 (cat. no. HY-12815) and 17-N-allylamino-17-demethoxygeldanamycin (17-AAG, cat. no. M2320-01) were purchased from MedChemExpress. The immunohistochemistry kit (cat. no. PV-9000) was purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd. Ethanol and dimethyl benzene were purchased from Tianjin Yongda Chemical Reagent Co., Ltd. The hematoxylin and eosin (H&E) Stain Kit (cat. no. G1120) and paraffin wax were purchased from Beijing Solarbio Science & Technology Co., Ltd. Primers used for reverse transcription-quantitative PCR (RT-qPCR) primers were synthesized by Sangon Biotech Co., Ltd.
+ Open protocol
+ Expand
3

Quantifying miR-195-5p and PDGF in Serum

Check if the same lab product or an alternative is used in the 5 most similar protocols
RT‐qPCR was employed to measure the miR‐195‐5p and PDGF levels in the serum of all enrolled study population. The whole blood samples were collected in a 1.5 mL centrifuge tube without RNA enzyme and stored in a refrigerator at −80°C. RNA concentration was determined within 1 week. The blood samples were centrifuged at 3000 rpm for 20 min to extract the supernatant. TRIzol reagent (Thermo Fisher, MA, USA) was utilized to extract total RNA of the samples. Total RNA was isolated using mirVana PARIS kits and cDNA was synthesized by reverse transcription using PrimeScript RT Reagent kits (TaKaRa, Otsu, Shiga, Japan). The concentration and purity of extracted RNA was determined using ultrafine spectrophotometer (NanoDrop One, Thermo Fisher). ChamQ™ SYBR qRT‐PCR MasterMix (Vazyme Biotech, Nanjing, China) was adopted for the RT‐qPCR under reaction conditions of 95°C for 30 s, and 35 cycles of 95°C for 10 s and 60°C for 10 s. The relative levels of miR‐195‐5p and PDGF standardized by internal reference U6 and β‐actin were calculated by the 2−ΔΔCt method (Livak and Schmittgen, 2001 (link)). RT‐qPCR primers were synthesized by Sangon Biotech (Shanghai, China) and the primer sequences are shown in Table 1.
+ Open protocol
+ Expand
4

AQP5 Expression in A253 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The A253 cells were obtained from Zhejiang Meisen Cell Biotechnology Co., Ltd. Fetal bovine serum (Ocamar Technologies Co., Ltd., Shanghai, China). 1640 medium (Ocamar Technologies Co., Ltd., Shanghai, China). Total RNA extraction kit (Shanghai Hengyuan biochemical reagent Co., Ltd., China), IFN-γ (Guangzhou Ruiqian Biotechnology Co., Ltd., China), anti-rabbit monoclonal AQP5 antibody (Abcam, UK, 1:200). Anti-rabbit secondary antibody (Proteintech, China, 1:5000). Hematoxylin and Eosin Staining kit (Wuhan Servicebio Technology Co. Ltd., China). RT-qPCR kit (Invitrogen, USA). RT-qPCR primers (Sangon Biotech, Shanghai, China).
+ Open protocol
+ Expand
5

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells with TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.). cDNA synthesis was performed using the TOYOBO ReverTra Ace qPCR RT kit, according to the manufacturer's protocol. qPCR was performed using the KAPA SYBR-Green Supermix PCR kit (Kapa Biosystems). RT-qPCR primers were obtained from Sangon Biotech Co., Ltd.; sequences are listed in Table II. The reaction was started at 95°C for 5 min, followed by 40 cycles of 95°C for 30 sec, 61°C for 30 sec, and 72°C for 30 sec. Relative gene expression levels were measured using the cycle threshold values and the 2−ΔΔCq method (20 (link)).
+ Open protocol
+ Expand
6

Real-time RT-qPCR for RAC1 expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). RT-qPCR was then performed. The RT-qPCR primers for RAC1 and GAPDH (internal control) were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). RT was performed using a FastQuant RT kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's protocol. The PCR primers for RAC1 and GAPDH were as follows: RAC1, forward 5′-ATGTCCGTGCAAAGTGGTATC-3′, reverse 5′-CTCGGATCGCTTCGTCAAACA-3′; and GAPDH, forward 5′-GCCAAAAGGGTCATCATCTC-3′ and reverse 5′-GTAGAGGCAGGGATGATGTTC-3′. qPCR was performed using Taq PCR MasterMix (Tiangen Biotech Co., Ltd.) and a ViiA™ system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The thermal cycling conditions were as follows: Initial denaturation at 95°C for 60 sec, 40 cycles of amplification at 95°C for 20 sec, annealing and extension at 60°C for 30 sec. GAPDH was used as an internal control for PCR amplification. The data were analyzed using the 2−ΔΔCt method (25 (link)).
+ Open protocol
+ Expand
7

Quantitative Real-Time PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RT-qPCR was used to assess the relative abundance of mRNA. RT-qPCR primers were obtained from Sangon Biotech (Shanghai, China), and the sequences were listed in Additional file 1. According to the manufacturer’s instructions, RT-qPCR was performed through using the SYBR Prime-Script RT-PCR Kit (Takara, Beijing, China) with a 7500 Fast Real-Time PCR System (Thermofisher Scientific, New York, USA). The reaction started at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 34 s, then entered the dissociation stage (95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s). GAPDH (for mRNA expression level) was used as an internal control to normalize qPCR results. Relative gene expression levels were measured using cycle threshold (CT) values in the ΔΔCT calculation. Each experiment was performed in triplicates and repeated three times.
+ Open protocol
+ Expand
8

CaMKII and Cx43 Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
TransScript II All-in-One First-Strand cDNA Synthesis SuperMix for PCR and TransScript II SYBR-Green Two-Step RT-qPCR SuperMix kit (AH321-01 and AQ301-01; both from Transgen Biotech Co., Ltd.); RT-qPCR primers [Sangon Biotech (Shanghai) Co., Ltd.]; Trizol kit (10296028; Thermo Fisher Scientific, Inc.); RIPA lysis buffer, BCA kit and ECL chromogenic reagent (P0013C, P0012S, and P0018FS; all from Beyotime Institute of Biotechnology); monoclonal rabbit anti-rat CaMKII, monoclonal rabbit anti-rat Cx43, and monoclonal rabbit anti-rat β-actin antibodies, as well as polyclonal horseradish peroxidase (HRP)-labeled goat anti-rabbit secondary antibody (ab5683, ab79010, ab179467, and ab6728; all from Abcam); KN93 (CSN11255; CSNpharm).
+ Open protocol
+ Expand
9

Quantifying Gene Expression in HepG2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cultured HepG2 cells using the TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The RNA was eluted with RNasefree water and the concentration was measured by UV detection at 260 nm. Subsequently, cDNA was synthesized using the Transcriptor First-Strand cDNA Synthesis kit (Takara Bio, Inc.). qPCR was performed with SYBR-Green Master Mix (Takara Bio, Inc.). The thermocycling conditions were as follows: Initial denaturation at 95°C for 30 sec, followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec. The RT-qPCR primers were purchased from Sangon Biotech Co., Ltd. The fold-change for mRNA relative to β-actin was determined using the 2-∆∆Cq method (19 (link)). The specific primer sequences were as follows: CYP4A11 (human) forward, 5′-ACG GCT TGC TCC TGT TGA AT GG-3′; CYP4A11 reverse, 5′-AGA GGT CAG GCT GTA GAT GGT GTC-3′; IL-6 (human) forward, 5′-CAC ACA GAC AGC CAC TCA CC-3′; IL-6 reverse, 5′-AGT GCC TCT TTG CTG CTT TC-3′; TNF-α (human) forward, 5′-AAC CTC CTC TCT GCC ATC AA-3′; TNF-α reverse, 5′-CTG AGT CGG TCA CCC TTC TC-3′; IL-1β forward, 5′-GGA CAA GCT GAG GAA GAT GC-3′; IL-1β reverse, 5′-TCG TTA TCC CAT GTG TCG AA-3′; β-actin forward, 5′-TTG CTG ACA GGA TGC AGA A-3′; and β-actin reverse, 5′-ACC AAT CCA CAC AGA GTA CTT-3′.
+ Open protocol
+ Expand
10

Quantifying mRNA Expression by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
RT-qPCR was used to assess the relative abundance of mRNA. RT-qPCR primers were obtained from Sangon Biotech (Shanghai, China), and the sequences were listed in Additional le 1. According to the manufacturer's instructions, RT-qPCR was performed through using the SYBR Prime-Script RT-PCR Kit (Takara, Beijing, China) with a 7500 Fast Real-Time PCR System (Thermo sher Scienti c, New York, USA). The reaction started at 95℃ for 30 seconds, followed by 40 cycles of 95℃ for 5 seconds, 60℃ for 34 seconds, then entered the dissociation stage (95℃ for 15 seconds, 60℃ for 1 minute, and 95℃ for 15 seconds). GAPDH (for mRNA expression level) was used as an internal control to normalize qPCR results. Relative gene expression levels were measured using cycle threshold (CT) values in the ΔΔCT calculation. Each experiment was performed in triplicates and repeated three times.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!