Pet28b

Manufactured by Thermo Fisher Scientific

Sourced in United States

The PET28b is a plasmid vector designed for the expression and purification of recombinant proteins in Escherichia coli. It contains a T7 promoter for high-level expression and a His-tag sequence for convenient protein purification using affinity chromatography.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

PET28b vector (9 citations) PET28b expression vector (2 citations)

13 protocols using pet28b

Evaluating Antimicrobial Resistance Genes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To evaluate the impact of resistance-determinant genes on MICs, bla_OXA–1045 and bla_OXA–213 were cloned into the vector pET28b (MiaoLingBio, Wuhan, China). To make pET28b-OXA1045 and pET28b-OXA213, PCR amplification and vector pET-28b were digested with BamHI and XhoI and then ligated to the pET-28b vector (Invitrogen, Carlsbad, California, United States). As previously described, the generated plasmid was chemically converted into E. coli strain BL21 (Sigma-Aldrich, St. Louis, MO, United States) (Liu et al., 2021 (link)). Potential transformants containing pET28b-OXA1045 were identified on LB agar plates (Sigma-Aldrich, St. Louis, MO, United States) containing 20 mg/L of kanamycin (TransGen, Beijing, China). PCR primers PET28AVF2/PET-VF were used to screen colonies on plates, followed by Sanger sequencing (Supplementary Datasheet 1). The empty vector pET-28b was turned into BL21 for use as a control.
MICs of ampicillin, ampicillin-sulbactam, piperacillin, piperacillin-tazobactam, oxacillin, cefazolin, cefoxitin, cefuroxime, ceftazidime, cefotaxime, imipenem, and meropenem for the transformants containing pET28b-OXA1045 (BL21:pET28b-OXA1045) and pET28b-OXA213 (BL21:pET28b-OXA213) were determined by the broth microdilution method. MICs for ampicillin in the presence of 4 mg/L of sulbactam were also determined based on the methods used to establish MICs for piperacillin-tazobactam.

Ding Z., Li Z., Zhao Y., Hao J., Li T., Liu Y., Zeng Z, & Liu J. (2022). Phenotypic and Genotypic Characteristics of a Tigecycline-Resistant Acinetobacter pittii Isolate Carrying blaNDM–1 and the Novel blaOXA Allelic Variant blaOXA–1045. Frontiers in Microbiology, 13, 868152.

+ Open protocol

+ Expand

Recombinant Expression and Purification of Dachs Domains

Check if the same lab product or an alternative is used in the 5 most similar protocols

The DNA fragments corresponding to amino acids 1–280 (Dachs N) and 1,013–1,232 (Dachs C) were amplified from UAS-dachs:V5 (Mao et al., 2006 (link)), cloned into pET28b (Invitrogen), and transformed into Escherichia coli BL 21(DE3). His-tagged proteins were induced with IPTG, purified with Ni-NTA resin (QIAGEN), dialyzed against PBS, and used to immunize rats (Panigen).

Matakatsu H., Blair S.S, & Fehon R.G. (2017). The palmitoyltransferase Approximated promotes growth via the Hippo pathway by palmitoylation of Fat. The Journal of Cell Biology, 216(1), 265-277.

+ Open protocol

+ Expand

Purification of scFv-VRC01 Antibody

Check if the same lab product or an alternative is used in the 5 most similar protocols

The synthesized scFv-VRC01 gene fragment was removed from the original vector pUC57 using the restriction enzymes BamH1 and Xhol, and then ligated into an E. coli expression vector pET28b (Invitrogen). The vector containing scFv-VRC01 gene was transformed into E. coli BL21 (ADE3) bacterial cells for protein expression. After transformation, the selected positive colonies were cultured and induced by 0.5mM IPTG (isopropylthio-p-galactoside) for 3 hrs at 37°C. After induction, the cells were collected by centrifugation and then disrupted by sonication. To purify the protein from inclusion bodies, the precipitates were dissolved in 8M urea and purified by Ni-NTA affinity chromatography under denaturing conditions. The protein was dialyzed for 24 hrs at 4°C in refolding buffer containing 50mM Tris-HCL, 0.5M L-Arginine, 50mM NaCl and 10% glycerol. The protein concentration of purified scFv-VRC01 protein was measured by BCA protein assay (Pierce) and stored at −80°C.

Wang L.X., Mellon M., Bowder D., Quinn M., Shea D., Wood C, & Xiang S.H. (2014). Escherichia coli Surface Display of Single-Chain Antibody VRC01 against HIV-1 infection. Virology, 475, 179-186.

+ Open protocol

+ Expand

Bacterial Surface Display Protocols

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Escherichia coli K-12 strain DH5α, Escherichia coli BL21 (λDE3) (Novagen) E. coli K12 strain UT5600 (ΔompT) were used for surface display (Lum and Morona, 2012 (link); Maurer et al., 1997 (link)). pET22b, pET28b (Invitrogen) and PUC57 (GenScript) were used for cloning.

Wang L.X., Mellon M., Bowder D., Quinn M., Shea D., Wood C, & Xiang S.H. (2014). Escherichia coli Surface Display of Single-Chain Antibody VRC01 against HIV-1 infection. Virology, 475, 179-186.

+ Open protocol

+ Expand

Purification and Antibody Generation of Dlish

Check if the same lab product or an alternative is used in the 5 most similar protocols

The full length dlish cDNA was amplified from pUAST-attB-Dlish-FLAG, in-fusion cloned into pET-28b(+) (Invitrogen), transformed into BL21(DE3)pLysS E. coli competent cells (Promega L1195), and protein expressed induced with 100 μM IPTG at 25°C for 13 hr. His-Dlish protein was purified with HisPur Ni-NTA Superflow Agarose (Thermo 25214), extracted, run on SDS-PAGE, and Coomassie stained. 4–5 mg of His-Dlish protein on the gel was used by Genemed Synthesis Inc. to immunize rabbits. Antiserum was affinity purified using GST-Dlish-coupled Sepharose.

Zhang Y., Wang X., Matakatsu H., Fehon R, & Blair S.S. (2016). The novel SH3 domain protein Dlish/CG10933 mediates fat signaling in Drosophila by binding and regulating Dachs. eLife, 5, e16624.

+ Open protocol

+ Expand

Disruption of yihW and crp genes in E. coli

Check if the same lab product or an alternative is used in the 5 most similar protocols

All strains and plasmids used in this study are listed in Supplementary Table S1 online. The yihW and crp genes were disrupted in E. coli BW25113 using recombineering^{42 (link)}. The gene::kan mutations were then transferred by P1-transduction into E. coli K-12 MG1655^{43 (link)} or M182, which is a lac-minus derivative of K-12^{34 (link)}. Cells were grown in the minimal salts (MS) medium supplemented with 5% or 10% (v/v) LB, 0.2% (w/v) of the appropriate carbon source - D-glucose, D-galactose, lactose or glycerol. Cultures were grown aerobically at 37 °C under constant shaking. Cells were harvested after 4.5 hours of growth (mid-log phase with OD~0.2–0.4, depending on the strain). To express the cAMP-CRP protein, E. coli BL21* (DE3) cells^{44 (link)} were chemically transformed with the pET_CRP plasmid constructed based on pET28b (Invitrogen), with the crp gene inserted between the NdeI and Bpu1102 sites. Purified transformants were grown on LB or Terrific broth (TB) at 37 °C till OD₆₅₀ = 0.3, and the protein synthesis was induced by addition of a very low IPTG concentration (20 μM) to avoid the effects of potential protein toxicity. The induction rate of CRP after 3 hours of IPTG induction was ~70% of the total protein (See Supplementary Fig. S1).

Kaznadzey A., Shelyakin P., Belousova E., Eremina A., Shvyreva U., Bykova D., Emelianenko V., Korosteleva A., Tutukina M, & Gelfand M.S. (2018). The genes of the sulphoquinovose catabolism in Escherichia coli are also associated with a previously unknown pathway of lactose degradation. Scientific Reports, 8, 3177.

+ Open protocol

+ Expand

Recombinant Protein Expression and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

His-tagged PLK1 or PPIL2 fragments were generated using the pET28b (Invitrogen) and GST-tagged ZNF830 fragments were generated using the pGEX6T-1 (GE Healthcare) system. His or GST-tagged recombinant protein were expressed in E. coli (BL21). After cell lysis, proteins were purified using Ni-NTA (Qiagen) or glutathione-Sepharose 4B (GE Healthcare) according to the manufacturer’s recommendations.
Full length or fragments GST-tagged ZNF830 and His-tagged PPIL2 were expressed in E. coli and GST-pulldown assay were performed as previously described (Wu et al., 2019 (link)).

Qiu Z., Hao S., Song S., Zhang R., Yan T., Lu Z., Wang H., Jia Z, & Zheng J. (2022). PLK1-mediated phosphorylation of PPIL2 regulates HR via CtIP. Frontiers in Cell and Developmental Biology, 10, 902403.

+ Open protocol

+ Expand

BTV-16 Viral Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The conserved region of VP2 (234 bp; nucleotide positions: 1012–1246, GenBank accession: KP339225) was amplified from BTV-16 complementary DNA using primers F (BamHI) 5’GGATCCgATGCGTTTCTATGTGTTGCTAAT3’ and R (EcoRI) 5’GAATTCTCAGTCAAAGAGGTTAACGCGCC3’ and cloned into expression vector pRSET-B (Invitrogen, US). For VP5 and NS1, codon optimised artificially synthesised BTV-16 full length genes (GenBank accession numbers: KF664138 and KF387525 for VP5 and NS1, respectively) were cloned in pET-28b (+) (Invitrogen, US).

Jyothi S.J., Patil S.R., Reddy N.Y., Panduranga R.P., Madala U., Prakash G.M, & Putty K. (2020). Implications of a conserved region of bluetongue virus protein VP2 in cross-neutralisation of bluetongue virus serotypes. The Onderstepoort Journal of Veterinary Research, 87(1), 1816.

+ Open protocol

+ Expand

Construction and Validation of Salmonella Typhi Strains

Check if the same lab product or an alternative is used in the 5 most similar protocols

The bacterial strains and plasmids used in this study are listed in Table S2. All S. Typhi strains are derived from the clinical isolate ISP2825 ^{45 (link)}. All in frame deletions or insertions into the S. Typhi chromosome were generated by standard recombinant DNA and allelic exchange procedures using the E. coli β-2163 Δnic35 as the conjugative donor strain ^{46 (link)} and the R6K-derived suicide vector pSB890 as previously described ^{47 (link)}. For S. Typhi ΔttsA complementation studies, we used plasmid pSB3783, which encodes an arabinose-inducible promoter and is derived from plasmid pBAD24 ^{48 (link)}. For TtsA expression for protein purification, we used the expression plasmid pET28b (Invitrogen) in E. coli strain BL21. All plasmids used in this study were constructed using the Gibson assembly cloning strategy ^{49 (link)}. All generated plasmids and strains used in this study have been verified by nucleotide sequencing.

Geiger T., Pazos M., Lara-Tejero M., Vollmer W, & Galán J.E. (2018). Peptidoglycan editing by a specific LD-transpeptidase controls the muramidase-dependent secretion of typhoid toxin. Nature microbiology, 3(11), 1243-1254.

+ Open protocol

+ Expand

Cloning of Dred_2421 Domain Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genes encoding for the domain variants of Dred_2421 were amplified by polymerase chain reaction (PCR) using the expression construct of Dred_2421 [14 ] as the template. GSU1371 and GSU3330 were amplified using the genomic DNA of G. sulfurreducens PCA as the template. EcDCR was amplified using E. coli genomic DNA as the template. The genes were cloned into the expression vector pET28b (Invitrogen). To generate the construct for Compact-CTD, overlapping PCR was used. Nucleotide sequences encoding for residues 375-523 and 553-668 were each amplified using the Dred_2421 construct as the template. The primers used for 375-523 were: 375-523-fwd: atat cat atg cctggtaaaattctagtgattggggccggtg; 375-523-rev: tcc TCCTCCTCCTCC ttcagccagtaatagagctgtttctacccc aacg. The primers for 553-668 were: 553-668-fwd: gaa GGAGGAGGAGGA ggaactaaaaagattacagttctgga gatggccaacg; 553-668-rev: atat ctcgag ttaatatttaatcgcctcattataagcctggtggattgcatcc. The restriction enzyme recognition sequences are indicated by underlines. The capitalized letters are part of the overlapping sequence and represent the four-glycine loop. A second round of PCR was performed using these two PCR products as the templates and the primers 375-523-fwd and 553-668-rev. The resultant PCR product was then cloned into pET28b.

Li Z., Kim D.D., Nelson O.D., Otwell A.E., Richardson R.E., Callister S.J, & Lin H. (2015). Molecular dissection of a putative iron reductase from Desulfotomaculum reducens MI-1. Biochemical and biophysical research communications, 467(3), 503-508.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!