U 13c glutamine

Manufactured by Cambridge Isotopes

Sourced in United States

[U-13C]-glutamine is a stable isotope-labeled compound that contains carbon-13 (13C) uniformly distributed throughout the glutamine molecule. It is used as a tracer in metabolic studies and research applications that require the detection and quantification of glutamine and its metabolic products.

Automatically generated - may contain errors

Lab products found in correlation

U 13c glucose, by Cambridge Isotopes (23 mentions) Sodium acetate, by Merck Group (3 mentions) U 13c acetate, by Cambridge Isotopes (3 mentions) 2 3 3 2h serine, by Cambridge Isotopes (3 mentions) U 13c palmitate, by Merck Group (3 mentions) Fetal bovine serum (fbs), by Wisent (3 mentions) 1 2 13c glucose, by Cambridge Isotopes (2 mentions) 5500 qtrap hybrid triple quadrupole mass spectrometer, by AB Sciex (2 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions) 5975 mass selective detector, by Agilent Technologies (2 mentions) U 13c lactate, by Cambridge Isotopes (2 mentions) U 13c pyruvate, by Cambridge Isotopes (2 mentions) Hoechst 33342, by Thermo Fisher Scientific (2 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions) D 6 14c glucose, by PerkinElmer (2 mentions) L glutamine, by Thermo Fisher Scientific (2 mentions) Dimethyl sulfoxide (dmso), by Merck Group (2 mentions) Cycloheximide (chx), by Merck Group (2 mentions) Tamoxifen, by Merck Group (2 mentions)

Close spelling variants of this product

Glutamine (7 citations) 13C-glutamine (4 citations) [U-13C]-L-glutamine (3 citations)

35 protocols using u 13c glutamine

Glutamine Isotope Tracing in Hypoxia

Check if the same lab product or an alternative is used in the 5 most similar protocols

Glutamine isotope tracing under normoxia or hypoxia involved SK-N-BE(2) and NB16 cells being pretreated with DMSO or 1 μM NEN for 3 h. Next, the culture medium was changed to DMEM/F-12 without glutamine (Gibco; 21331020) or supplemented with 4 mM U-¹³C-glutamine (Cambridge Isotope Laboratories; CLM-1822-H) or 10% dialyzed FBS (Gibco; 26400044) under normoxia or hypoxia for 2 h. Data are presented as mean ± SD across three biological replicates.

Jiang H., Greathouse R.L., Tiche S.J., Zhao M., He B., Li Y., Li A.M., Forgo B., Yip M., Li A., Shih M., Banuelos S., Zhou M.N., Gruber J.J., Rankin E.B., Hu Z., Shimada H., Chiu B, & Ye J. (2023). Mitochondrial uncoupling induces epigenome remodeling and promotes differentiation in neuroblastoma. Cancer research, 83(2), 181-194.

+ Open protocol

+ Expand

Metabolic Flux Analysis with Stable Isotopes

Check if the same lab product or an alternative is used in the 5 most similar protocols

For metabolic flux analyses, stable isotope-labelled compounds [1,2-¹³C]- glucose (CLM-504–0.5), [U-¹³C]-glucose (CLM-1396–0.5), [U-¹³C]-glutamine (DLM-1150–0.5), [2-²H]-glucose (DLM-1271–0.5), [3-²H]-glucose (DLM-9294-PK), [4-²H]-glucose (CLM-1822-H-0.25) were obtained from Cambridge Isotope Laboratories (Cambridge, MA) and [1-²H]-glucose was obtained from Omicron Biochemicals (South Bend IN, Cat No GLC-034). For stable isotope tracing in hepatocytes, the culture medium was replaced with glucose-free medium supplemented with 10mM ¹³C-labelled or ²H-labelled glucose or glutamine-free medium supplemented with 2 mM ¹³C-labelled L-glutamine. Metabolites of stable isotope-labelled compounds were tracked through the mitochondrial tricarboxylic acid (TCA) cycle, glycolysis, and the pentose phosphate pathway (PPP) ^{28 (link)}. Percent enrichment of labelled metabolites was compared between cells cultured with and without stable isotopes.

Oaks Z., Patel A., Huang N., Choudhary G., Winans T., Faludi T., Krakko D., Duarte M., Lewis J., B.e.c.k.f.o.r.d., Blair S., Kelly R., Landas S., Middleton F., Asara J., Chung S., Fernandez D., Banki K, & Perl A. (2023). CYTOSOLIC ALDOSE METABOLISM CONTRIBUTES TO PROGRESSION FROM CIRRHOSIS TO HEPATOCARCINOGENESIS. Nature metabolism, 5(1), 41-60.

+ Open protocol

+ Expand

Metabolomics and 13C Flux Analysis of Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols

Metabolomics profiling and ¹³C metabolic flux analysis were performed at the Beth Israel Deaconess Medical Center Mass Spectrometry Facility. Briefly, polar metabolites were collected by methanol-based extraction as previously described^{52 (link)}. Samples were re-suspended using HPLC grade water for mass spectrometry and analyzed using a 5500 QTRAP hybrid triple quadrupole mass spectrometer (AB/SCIEX) coupled to a Prominence UFLC HPLC system ^{52 (link)}. A total of 284 endogenous water-soluble metabolites were analyzed. For ¹³C metabolic flux analysis, macrophages were incubated for at least 4h with DMEM (without glucose, glutamine and pyruvate, Thermo) supplemented with 10% dialyzed FBS (Thermo), glucose (25 mM, Thermo) and [U-¹³C]-glutamine (2mM, Cambridge Isotope Laboratories). Polar metabolites were extracted as described above and analyzed as previously described^{53 (link)}. Statistical analysis was performed using MetaboAnalyst (http://www.metaboanalyst.ca, free online software).

Gioia M.D., Spreafico R., Springstead J.R., Mendelson M.M., Joehanes R., Levy D, & Zanoni I. (2019). Endogenous oxidized phospholipids reprogram cellular metabolism and boost hyperinflammation. Nature immunology, 21(1), 42-53.

+ Open protocol

+ Expand

Tracing Metabolic Flux in Hypoxic Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

shCTRL or shPCK1 LS174T cells were plated at 3 × 10⁵ cells per well in a 6-well plate and allowed to adhere to the plate for 24 hr. Cells were then pre-treated with RPMI-1640 media containing 6 mM glucose at 0.5% O₂ for 6 hr, then replaced with RPMI-1640 media containing 2 mM U-¹³C-glutamine (Cambridge Isotope Laboratories, #CLM-1822-H) for 0–6 hr at 0.5% O₂. Metabolites were extracted at 0, 2, 4, and 6 hr time points.

Yamaguchi N., Weinberg E.M., Nguyen A., Liberti M.V., Goodarzi H., Janjigian Y.Y., Paty P.B., Saltz L.B., Kingham T.P., Loo J.M., de Stanchina E, & Tavazoie S.F. (2019). PCK1 and DHODH drive colorectal cancer liver metastatic colonization and hypoxic growth by promoting nucleotide synthesis. eLife, 8, e52135.

+ Open protocol

+ Expand

Isotopic Tracing of Cellular Metabolism

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were cultured in RPMI 1640 supplemented with 10% heat-inactivated dialyzed FBS and containing either [U-¹³C]-glucose or [U-¹³C]-glutamine (Cambridge Isotopes Laboratories) in place of the corresponding unlabeled nutrient. Contribution of glucose or glutamine to total cellular carbon was measured after multiple passages in medium containing carbon-13. Contribution of glutamine to total cellular nitrogen was measured for cells grown in RPMI 1640 supplemented as above but containing [amide-¹⁵N]- or [α-¹⁵N]-glutamine (supplemented at 4% of total glutamine). Carbon-13 and nitrogen-15 enrichment (i.e. ¹³C:¹²C and ¹⁵N:¹⁴N) were measured by isotope ratio mass spectrometry (IRMS) (see Supplementary Experimental Procedures).

Hosios A.M., Hecht V.C., Danai L.V., Johnson M.O., Rathmell J.C., Steinhauser M.L., Manalis S.R, & Vander Heiden M.G. (2016). Amino acids rather than glucose account for the majority of cell mass in proliferating mammalian cells. Developmental cell, 36(5), 540-549.

+ Open protocol

+ Expand

Isotopic Tracing of T Cell Metabolism

Check if the same lab product or an alternative is used in the 5 most similar protocols

T cells were stimulated for 24 hours with immobilized anti-CD3 and anti-CD28. All labeling experiments were performed with 1 million cells/mL in RPMI. Glycose free or glutamine free media were replaced by their respective uniformly ¹³C-labeled analog (i.e. [U-¹³C]glucose or [U-¹³C]glutamine; Cambridge Isotope Laboratories). Cells were cultured for 24 hours and then pelleted, and lysed in cold 50% methanol. Analyses were performed at the CRI Metabolomics Core, UT Southwestern. Lysates underwent three freeze-thaw cycles, followed by centrifugation to remove debris. The supernatants were evaporated, methoximated and derivatized by tert-butyl dimethylsilylation. Derivatized material (1 mL) was injected onto an Agilent 6970 gas chromatograph equipped with a fused silica capillary GC column (30 m length, 0.25 mm diameter) and networked to either an Agilent 5973 or 5975 Mass Selective Detector. The measured distribution of mass isotopologues was corrected for natural abundance of ¹³C^{7 (link)}.

Tarasenko T.N., Banerjee P., Gomez-Rodriguez J., Gildea D., Zhang S., Wolfsberg T., Jenkins L.M, & McGuire P.J. (2023). Pyruvate dehydrogenase complex integrates the metabolome and epigenome in memory T cell differentiation in vitro. Research Square.

+ Open protocol

+ Expand

Investigating Lipid Metabolism Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

PGE₂, Butaprost, PF-04418948 and Iloprost were purchased from Millipore-Sigma. ONO-AE248 and ONO-AE1–329 were gifts from Ono Pharmaceuticals. C52 (Charnwood Molecular) and PF-04418948 (Millipore-Sigma) were resuspended in 40% PEG (Sigma-Aldrich) and 60% of a 30% Kolliphor HS15 solution (Sigma-Aldrich) and administered orally at 10 mg/kg/d and 2.5 mg/kg/d, respectively. U-¹³C-glucose, U-¹³C-lactate, U-¹³C-glutamine and U-¹³C-pyruvate were purchased from Cambridge Isotopes. HUSH-29 plasmids containing shRNAs to human GYS1 were purchased from Origene Technologies. Human MDMs were incubated with 1640 medium with GlutaMAX + HEPES without sodium pyruvate (Thermo Fisher Scientific, 72400146). Mouse macrophages were incubated in DMEM without sodium pyruvate (Sigma-Aldrich, D5796).

Minhas P.S., Latif-Hernandez A., McReynolds M.R., Durairaj A.S., Wang Q., Rubin A., Joshi A.U., He J.Q., Gauba E., Liu L., Wang C., Linde M., Sugiura Y., Moon P.K., Majeti R., Suematsu M., Mochly-Rosen D., Weissman I.L., Longo F.M., Rabinowitz J.D, & Andreasson K.I. (2021). Restoring metabolism of myeloid cells reverses cognitive decline in ageing. Nature, 590(7844), 122-128.

+ Open protocol

+ Expand

Mouse Transcription Factor Overexpression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

The constructs for mouse injection, including pT3-EF1α-c-MYC, pT3-EF1α-MCL1 and pCMV-SB (which encodes for sleeping beauty transposase), and pCMV-CRE (which encodes for CRE recombinase), were previously described⁵⁸. miR30-based shRNA targeting for Gls2 and Renilla Luciferase were cloned into pT3-EF1α-c-MYC. The shRNA sequences are: Gls2: CATCATGCCAACAAGCAACTT and Renilla Luciferase: AGGAATTATAATGCTTATCTA. All plasmids used for in vivo experiments were purified using the Endotoxin-free Maxiprep kit (Qiagen). [U-¹³C]-glucose, [U-¹³C]-glutamine, ¹⁵N-glutamine and ¹⁵N-alanine were purchased from Cambridge Isotope Laboratories, Inc.

Méndez-Lucas A., Lin W., Driscoll P.C., Legrave N., Novellasdemunt L., Xie C., Charles M., Wilson Z., Jones N.P., Rayport S., Rodríguez-Justo M., Li V., MacRae J.I., Hay N., Chen X, & Yuneva M. (2020). Identifying strategies to target the metabolic flexibility of tumours.. Nature metabolism, 2(4), 335-350.

+ Open protocol

+ Expand

Metabolic Tracing with Stable Isotopes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For metabolic tracing studies 150,000-200,000 cells/well were seeded in 6-well plates overnight. Cells were washed three times and 5mM [U-¹³C]glucose or 4mM [U-¹³C]glutamine (Cambridge Isotopes Laboratories) containing DMEM (10% dialysed serum, no pyruvate) was applied. After 24h of culture, metabolites were extracted from cells or media (10μL) in 80% methanol in water containing 1μg/sample norvaline and dried under nitrogen gas. Polar metabolites were derivatized and measured as described previously (Lewis et al., 2014 (link)). Relative metabolite abundances were calculated by integrating ion peak area and normalized to norvaline and later to the cell numbers from identical plates. Mass isotopomer distributions of each ion peak were determined after natural abundance corrections adapted from Fernandez et al. (1996) (link).

Alkan H.F., Walter K.E., Luengo A., Madreiter-Sokolowski C.T., Stryeck S., Lau A.N., Al-Zoughbi W., Lewis C.A., Thomas C.J., Hoefler G., Graier W.F., Madl T., Vander Heiden M.G, & Bogner-Strauss J.G. (2018). Cytosolic Aspartate Availability Determines Cell Survival When Glutamine Is Limiting. Cell metabolism, 28(5), 706-720.e6.

+ Open protocol

+ Expand

Metabolic Labeling Techniques in Cell Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

Collagen type 1 (rat tail) was from Millipore or from PureCol® (bovine) (Advanced Biomatrix, USA). The CPT1a inhibitor (+)-etomoxir sodium salt hydrate was purchased from CNIO Carlos III Therapies. Mitomycin C (MitoC), sodium palmitate, dimethyl sulfoxide (DMSO), NAC, sodium acetate, oligomycin, cycloheximide, cytidine, adenine, guanosine, methotrexate, carnitine, dNTP mix and tamoxifen were from Sigma-Aldrich (Bornem, Belgium). 5-fluorouracil (TEVA Pharma Belgium) was obtained from the pharmacy of the university hospital Leuven. Nucleoside mix was from Millipore (Belgium)¹⁵. Hoechst 33342 and L-homopropargylglycine (HPG) were from Molecular Probes and L-glutamine and penicillin/streptomycin were from Gibco® (Invitrogen, Life Technologies, Ghent, Belgium). Uniformly labeled [U-¹³C]-potassium palmitate, [U-¹³C]-acetate, [U-¹³C]-glucose, [U-¹³C]-glutamine and [U-¹³C]-algal fatty acid mix were obtained from Cambridge isotope laboratories, Inc. [U-¹⁴C]-palmitate, [9,10-³H]-palmitate, [6-¹⁴C]-D-glucose, [8-¹⁴C]-hypoxanthine and [³H]-thymidine were from Perkin Elmer.

Schoors S., Bruning U., Missiaen R., Queiroz K.C., Borgers G., Elia I., Zecchin A., Cantelmo A.R., Christen S., Goveia J., Heggermont W., Goddé L., Vinckier S., Van Veldhoven P.P., Eelen G., Schoonjans L., Gerhardt H., Dewerchin M., Baes M., De Bock K., Ghesquière B., Lunt S.Y., Fendt S.M, & Carmeliet P. (2015). Fatty acid carbon is essential for dNTP synthesis in endothelial cells. Nature, 520(7546), 192-197.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!