The largest database of trusted experimental protocols

29 protocols using sh nc

1

Silencing SNHG6 Enhances Cisplatin Sensitivity

Check if the same lab product or an alternative is used in the 5 most similar protocols
The present assay operated on mice were approved by the Ethics Committee of People’s Hospital of Zhengzhou, and all mice experiments took place at central laboratory of People’s Hospital of Zhengzhou. Five-week-old nude mice were procured from Beijing Laboratory Animal Center (Beijing, China). ∼ 2 × 106 AGS/DDP cells stably introduced with lentiviral vector silencing SNHG6 (sh-SNHG6; HanBio, Shanghai, China) or blank control (sh-NC; HanBio) were subjected for hypodermic injection in the right flank of the nude mice. One week later, the mice were subjected to intraperitoneal injection with DDP diluted in PBS (5 mg/kg) or only PBS 3 times per week (n=5). The size of tumors was measured once a week and computed exploiting the following formula: 0.5 × length × width2. After additional 4 weeks, all animals were euthanized with inhalation anesthesia of 5% isoflurane and cervical dislocation, and formed tumors were resected for weigh.
+ Open protocol
+ Expand
2

Establishing Stable TMSB4X Knockdown in Ovarian Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Three ovarian cancer cell lines were cultured for one day in 10 cm plates until they reached a subconfluent status. Then, using Lipofectamine 2000 (Invitrogen, Carlsbad, CA), we transfected the cancer cells with a TMSB4X-specific shRNA and a nontargeting scrambled shRNA (shNC) (Hanbio, Shanghai, China). An shRNA sequence targeting human TMSB4X (target sequence: 5′-CCGGGAAGACAGAGACGCAAGAGAACTCGAGTTCTCTTGCGTCTCTGTCTTCTTTTTTG-3′) or a nontargeting control (target sequence: 5′-GCACTACCAGAGCTAACTCAGATAGTACT-3′) was used. The transfected cells were isolated as single clones after puromycin treatment to establish lines with stable TMSB4X knockdown.
+ Open protocol
+ Expand
3

Efficient Cell Transfection Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
The vectors used for cell transfection were obtained from Hanbio (Shanghai, China) and included sh-circ_0029463 (circ_0029463 suppression), sh-NC, oe-WTAP (WTAP overexpression), oe-NC, in-miR-134-5p (miR-134-5p inhibitor), in-NC (inhibitor NC), miR-134-5p mimic, mimic NC, oe-Rab27a (Rab27a overexpression), and oe-NC. After 48 h of cell transfection, the viral titer in the transfected 293 T cells was measured using a p24 ELISA kit (Cell Biolabs, Inc., San Diego, USA). BMMs were transfected for 24 h and further cultured for 48 h before the stably transfected cell lines were screened using puromycin (P8230; Solarbio, Beijing, China). Transfection efficiency was validated before cell biological functions were assessed.
+ Open protocol
+ Expand
4

Adenoviral shRNA Knockdown of Mouse HSP60

Check if the same lab product or an alternative is used in the 5 most similar protocols
Three shRNAs targeting the mouse HSP60 mRNA and a nontargeting control shRNA (shNC) were designed and synthesized by Hanbio Biotechnology (Shanghai, China). Three sequences targeting HSP60 mRNA were as follows: 5′-GATCCGTGCCACTGTTCTGGCACGATCTATTCTCGAGAATAGATCGTGCCAGAACAGTGGCATTTTTTG-3′, 5′-GATCCGATGTTGGCTGTGGATGCTGTAATTCTCGAGAATTACAGCATCCACAGCCAACATCTTTTTTG-3′, and 5′-GATCCGTCAGTCCATTGTCCCTGCTCTTGAACTCGAGTTCAAGAGCAGGGACAATGGACTGATTTTTTG-3′. These sequences were cloned into the vector pHBLV-shRNA-ZsGreen-PURO, and adenoviruses carrying the recombinant vector were generated as previously described (62 (link)).
+ Open protocol
+ Expand
5

Targeted Knockdown of Epigenetic and Signaling Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
Small interfering RNAs (siRNAs) targeting the Kdm4e (si-Kdm4e), Dux4 (si-Dux4), and scramble siRNA (si-NC) genes were constructed by Tsingke Biotechnology Co., Ltd. (Beijing, China). Cells grown to 60% confluence were transfected with these siRNAs using Xfect RNA transfection reagent (TaKaRa, 631450) according to the manufacturer’s protocol. The final concentrations of siRNAs was 100 pM. Adenoviruses carrying short hairpin RNAs targeting the Rptor gene (sh-Rptor#1 and sh-Rptor#2) or a scramble RNA (sh-NC) were constructed by Hanbio Co., Ltd. (Shanghai, China). Cells at 60% confluence were transfected with sh-Rptor#1, sh-Rptor#2, or sh-NC for 8 h at an MOI of 50. The medium was removed and fresh medium added, and the cells were then cultured for 48 h before use in experiments. The siRNA and shRNA sequences are listed in supplementary Table 3.
+ Open protocol
+ Expand
6

Lentiviral knockdown of LINC01003 in glioma

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant lentiviruses for knocking down LINC01003 (sh-LINC01003) and the corresponding control viruses (sh-NC) were purchased from HANBIO (Shanghai, China). Glioma cell U87MG (15 × 104 cells/well) were seeded into a 6-well plate and transfected with the lentivirus according to the manufacturer’s instructions. Infected cells were treated with 5 μg/ml puromycin for more than 7 days.
+ Open protocol
+ Expand
7

Lentiviral Knockdown of OIP5-AS1 in NPC

Check if the same lab product or an alternative is used in the 5 most similar protocols
The lentivirus expressing small hairpin RNA sh-OIP5-AS1 or negative control (sh-NC) was obtained from Hanbio Co., Ltd. (Shanghai, China) and then transduced into NPC cell lines using polybrene (Hanbio Co., Ltd.). miR-203-inhibitor or negative control (GenePharma Co., Ltd., Shanghai, China) was transfected into cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions. The sequence of sh-OIP5-AS1 is as follows: 5′-CAAACAGGCUUUGUGUUCCUUAUCA-3′.
+ Open protocol
+ Expand
8

HOXA11-AS Knockdown Inhibits Xenograft Tumor Growth

Check if the same lab product or an alternative is used in the 5 most similar protocols
BALB/c nude mice (n = 20, male, 6–8 weeks old) were purchased from Laboratory Animal Center of Zhengzhou University (Zhengzhou, China) and fed or treated following the national standards of the care and use of laboratory animals. Also, our animal experiments got the approval of Institutional Animal Care and Use Committee of Gansu Provincial Cancer Hospital. Mice were randomly divided into shNC and shHOXA11-AS groups with 10 mice in each group. Lentiviruses carrying HOXA11-AS knockdown fragment (shHOXA11-AS) and the control lentiviruses (shNC) were customized from Hanbio Biotechnology Co., ltd. For xenograft experiments, H460 cells (107 cells/mice) infected with shNC or shHOXA11-AS lentiviruses were subcutaneously injected into the flanks of mice in shNC or shHOXA11-AS group, respectively. Tumor volume was measured every 3 days for a total of 27 days using a caliper and estimated using the formula: volume = 0.5 × length × width.2 (link) Twenty-seven days later, mice were killed and tumors were excised, weighed, and stored for the following RT-qPCR and Western blot assays.
+ Open protocol
+ Expand
9

Lentiviral shRNA Knockdown of HK2

Check if the same lab product or an alternative is used in the 5 most similar protocols
shRNA targeting HK2 (shHK2) and a negative control shRNA (shNC) were synthesized by Hanbio Biotechnology (Shanghai, China). The sequence of HK2 shRNA (GATCCGCCACAACTGTGAGATTGGTCTCATTTTCAAGAGAAATGAGACCAATCTCACAGTTGTGGTTTTTTC) was inserted into BamHI and EcoRI sites of pHBLV-U6-Scramble-ZsGreen-Puro. Recombinant lentivirus was constructed by Hanbio Biotechnology (Shanghai, China). Mouse anti-human HK2 antibody was purchased from Abcam (UK). Cell counting kit-8 (cck-8) was purchased from Sangon Biotech (Shanghai, China). Annexin V-FITC/PI Apoptosis kit was purchased from Bestbio (Shanghai, China).
+ Open protocol
+ Expand
10

Murine Hindlimb Ischemia Model with SIRT1 Modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
We used a previously described mice model of unilateral hindlimb ischemia 1 (link). In brief, the mice (male, 12-14 week-old) were anesthetized with a mixture of oxygen and 1.125% isoflurane. Left unilateral femoral artery occlusion was performed by double ligation of the left superficial femoral artery proximal and distal to the deep femoral artery. Animal numbers are stated with the different experimental results. A sham operation was performed on the contralateral right leg. At the same time, for activation or inhibition of SIRT1, the mice were treated with SIRT1 agonist RSV (2 mg/kg/d, J&K) or inhibitor EX527 (2 mg/kg/d, Cayman) by intraperitoneal injection. For intramuscular injection of AAV 21 (link), 3 weeks before SIRT1-Tg mice were performed left unilateral femoral artery occlusion, left gastrocnemius muscles were injected with 1×1012 vg /mL AAV9-shRNA-cZFP609 (adeno-associated virus-9 short-hairpin RNA; shcZFP609, HANBIO) and AAV9-shRNA-NC (shNC, HANBIO) by multi-point injection, the injection volume was 10 μL per point, 5 points in total. On day 14 after surgery, mice were euthanized by injection of pentobarbital (80 mg/kg IP) 22 (link), the gastrocnemius tissues were harvested and placed in FSC 22 Frozen Section Media (Leica, 3801480), and three random 10 μm frozen sections of the gastrocnemius muscle per animal were used for immunofluorescence analyses.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!