Mytaq red dna polymerase

Manufactured by Meridian Bioscience

Sourced in United Kingdom, United States

MyTaq Red DNA polymerase is a thermostable DNA polymerase designed for reliable and efficient amplification of DNA fragments. It provides enhanced specificity, sensitivity, and speed for a wide range of PCR applications.

Automatically generated - may contain errors

Lab products found in correlation

31 protocols using mytaq red dna polymerase

Isolation and Detection of circRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA and RNA from nuclear/cytoplasmic fractionations was isolated using the Direct-zol RNA MiniPrep Kit with on-column DNAse treatment, according to the manufacturer's instructions (Zymo Research).
RNaseR treatment was performed on total RNA extracted from mouse EBs at day 6 of differentiation; 6 U of RNaseR (RNR07250, Epicentre) was used for 1 μg of RNA and the reaction was carried out for 15′ at 37 °C; the RNA was then extracted using the Direct-zol RNA MiniPrep Kit (Zymo Research).
For RNA retro-transcription, the SuperScript VILO cDNA Synthesis Kit was used (Thermo Fisher Scientific).
For the detection of circRNAs and their linear counterparts, cDNA samples were analysed by quantitative real-time PCR using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific).
For the RNA extracted in CLIP experiments, semi-quantitative PCR was performed on cDNAs using MyTaq Red DNA Polymerase (Bioline) according to the manufacturer's instructions. The samples were then loaded on a 2.5% agarose gel. All the images were captured using the Molecular Imager ChemiDoc XRS+ (Bio-Rad), and the densitometric analyses were performed using the associated Image Lab software (Bio-Rad).
The oligonucleotides used in all the amplification steps are listed in Supplementary Table 1.

Errichelli L., Dini Modigliani S., Laneve P., Colantoni A., Legnini I., Capauto D., Rosa A., De Santis R., Scarfò R., Peruzzi G., Lu L., Caffarelli E., Shneider N.A., Morlando M, & Bozzoni I. (2017). FUS affects circular RNA expression in murine embryonic stem cell-derived motor neurons. Nature Communications, 8, 14741.

+ Open protocol

+ Expand

Genotyping Luciferase Knock-In Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Animals were used for the following experiments in accordance with the UK Animal Welfare Act; the experiments were approved by the Home Office (Scotland). Genomic DNA (gDNA) was extracted from ear biopsies by standard protocols (65). Equimolar concentrations of a common reverse primer (K12KI.R): 5′ TGA ACG GAA CTG TAC TTC TGT G 3′ and either K12KI.2F: 5′ ACG TCC AGA CAC AGC ATA GG 3′ or K12KI.1F (5′ GCT GTG GAG GCC TCT TTT C 3′) were used to detect the luciferase knock-in allele (299 bp product) and/or the WT allele (553 bp product), respectively (Fig. 2a). PCR conditions consisted of an initial denaturation step for 5 minutes at 95°C, 35 cycles of 15 seconds denaturation at 95°C, 15 seconds annealing at 60°C, and 30 seconds elongation at 72°C, followed by a final elongation step of 5 minutes at 72°C using MyTaq Red DNA polymerase (Bioline, London, UK).

Fu D.J., Allen E.H., Hickerson R.P., Leslie Pedrioli D.M, & McLean W.H. (2020). Development of a Corneal Bioluminescence Mouse for Real-Time In Vivo Evaluation of Gene Therapies. Translational Vision Science & Technology, 9(13), 44.

+ Open protocol

+ Expand

Amplification and Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Amplification reactions were carried out in a T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA) using KAPA HiFi DNA polymerase (Kapa Biosystems, Wilmington, MA, USA) or MyTaq Red DNA polymerase (Bioline, Memphis, TN, USA) according to the instructions of the suppliers. Oligonucleotides are described in Table 3. Constructs were sequenced with an automated DNA sequencer (Stab Vida, Oeiras, Portugal).

Araujo-Garrido J.L., Baisón-Olmo F., Bernal-Bayard J., Romero F, & Ramos-Morales F. (2020). Tubulin Folding Cofactor TBCB is a Target of the Salmonella Effector Protein SseK1. International Journal of Molecular Sciences, 21(9), 3193.

+ Open protocol

+ Expand

cDNA Synthesis and qPCR Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

First, 0.1 μg of RNA were used for cDNA synthesis using Oligo‐dT (Invitrogen #18418012), RNase OUT (Invitrogen #10777‐014) and SuperScriptII Retrotranscriptase (Invitrogen #18064‐014). PCR products were obtained using 5 ng of cDNA and Mytaq Red DNA Polymerase (Bioline #BIO‐21108) following the manufacturer's instructions. Oligonucleotides used for amplification are provided in Table S2.

Fernández‐Muñoz B., Rosell‐Valle C., Ferrari D., Alba‐Amador J., Montiel M.Á., Campos‐Cuerva R., Lopez‐Navas L., Muñoz‐Escalona M., Martín‐López M., Profico D.C., Blanco M.F., Giorgetti A., González‐Muñoz E., Márquez‐Rivas J, & Sanchez‐Pernaute R. (2020). Retrieval of germinal zone neural stem cells from the cerebrospinal fluid of premature infants with intraventricular hemorrhage. Stem Cells Translational Medicine, 9(9), 1085-1101.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA for expression analysis was extracted as described in Stam et al. (2000). DNA was removed using the TURBO DNase kit (Ambion applied Biosystems) and converted to cDNA using M‐MLV reverse transcriptase and oligo‐dT primers (Invitrogen) according to the manufacturer's instructions. Semiquantitative PCR was carried out using MyTaq Red DNA Polymerase (Bioline) and qPCR was carried out using SsoFast Eva Green Supermix (Bio‐Rad) according to the manufacturer's instructions. cDNA levels were normalized using eukaryotic translation initiation factor 3 primers GAGCGATGGATGGTGAATCT + TTGTACGTGCGTCCAGAAAG.
CEN1.1 expression was analyzed using primers GACCCTGATGCTCCAAGTCC + TGGCTGCAGTTTCTCTCTGG.

Hollwey E., Out S., Watson M.R., Heidmann I, & Meyer P. (2017). TET3‐mediated demethylation in tomato activates expression of a CETS gene that stimulates vegetative growth. Plant Direct, 1(4), e00022.

+ Open protocol

+ Expand

Validating Alternative Splicing Changes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Alternative splicing changes identified from RNA-seq were validated by RT-PCR using specifically designed primers (Supplementary Table 3). To confirm cassette exons, the primers were adjacent to the predicted splicing event. This approach allowed us to discriminate between variants based on their fragment sizes. For alternative first exon usage (AFE) validation, we have designed primers spanning regions that are unique to the isoform of interest (Fig. 6g), and then normalized the results by the housekeeping gene β-actin. cDNA was amplified using MyTaq Red DNA polymerase (Bioline, London, UK), and PCR products were analyzed using an Agilent 2100 Bioanalyzer system (Agilent Technologies, Wokingham, U.K.). The molarity of each PCR band corresponding to a specific splice variant was quantified using the 2100 Expert Software (Agilent Technologies, Diegem, Belgium), and used to calculate the ratio inclusion/exclusion (SE) or isoform-X/β-actin (AFE).

Colli M.L., Ramos-Rodríguez M., Nakayasu E.S., Alvelos M.I., Lopes M., Hill J.L., Turatsinze J.V., Coomans de Brachène A., Russell M.A., Raurell-Vila H., Castela A., Juan-Mateu J., Webb-Robertson B.J., Krogvold L., Dahl-Jorgensen K., Marselli L., Marchetti P., Richardson S.J., Morgan N.G., Metz T.O., Pasquali L, & Eizirik D.L. (2020). An integrated multi-omics approach identifies the landscape of interferon-α-mediated responses of human pancreatic beta cells. Nature Communications, 11, 2584.

+ Open protocol

+ Expand

EGFR and EGFRvIII Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells or EVs using TRIzol Reagent (Invitrogen # 15596026) and RNeasy Mini Kit (Qiagen # 74104, Mississauga, ON, Canada) according to manufacturer’s recommendations. The cDNA obtained was then amplified using human EGFR and EGFRvIII primers (see Supplementary information for details) and PCR was performed on 2.5 μL of prepared cDNA using MyTaq Red DNA Polymerase (Bioline, London, UK). Amplified PCR products were resolved on 2% agarose gel for 30 min at 100 V and the DNA bands were visualised using ultraviolet (UV) transilluminator gel documentation system.

Spinelli C., Adnani L., Meehan B., Montermini L., Huang S., Kim M., Nishimura T., Croul S.E., Nakano I., Riazalhosseini Y, & Rak J. (2024). Mesenchymal glioma stem cells trigger vasectasia—distinct neovascularization process stimulated by extracellular vesicles carrying EGFR. Nature Communications, 15, 2865.

+ Open protocol

+ Expand

Reverse Transcription and Semi-Quantitative PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

One microgram of total RNA from each section was reverse-transcribed to cDNA using Tetro cDNA synthase kit (Bioline, London, UK) as per the manufacturer’s instructions. Semi-quantitative PCR was performed using My-Taq red DNA polymerase (Bioline, London, UK) with 1 μl cDNA as template. Thirty cycles of the following amplification program was used: 95°C 15 sec, 55°C 15 sec, 72°C 10 sec. PCR primer sequences are listed in S2 Table.

Song L., Zeng W., Wu A., Picard K., Lampugnani E.R., Cheetamun R., Beahan C., Cassin A., Lonsdale A., Doblin M.S, & Bacic A. (2015). Asparagus Spears as a Model to Study Heteroxylan Biosynthesis during Secondary Wall Development. PLoS ONE, 10(4), e0123878.

+ Open protocol

+ Expand

Fetal Sex Determination from Rat Placenta

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated from weighed rat placental tissues using Tri Reagent solution, according to the manufacturer’s instructions. The purity of the isolated DNA was checked by measuring the A260/A280 ratio and the total DNA concentration was calculated from the A260 measurement.
A single-step PCR method ^{52 (link)} was used to determine foetal sex from the rat placental tissue. Briefly, two unique forward primers for the X chromosome (5’-TTTGTACGACTAGGCCCCAC-3’) and Y chromosome (5’-TTGGTGAGATGGCTGATTCC-3’); and one common reverse primer (3’-GGTTTCTTAAACCGTCGCC-5’) were used for amplifications, yielding amplicons of 692 and 250 bp respectively. Endpoint PCR analysis was carried out in a 25 μl reaction volume using a T100TM Thermal Cycler (Bio-Rad). 10 ng of genomic DNA was amplified with the final concentration of 0.2 μM of forward and reverse primers and 0.625 units of MyTaq™ Red DNA Polymerase (Bioline) according to the manufacturer’s instructions. As positive controls, samples of genomic DNA isolated from male and female rat kidney were used. The PCR amplification conditions were as follows: 95°C for 1 minute followed by 30 cycles at 95°C for 15 s, 52°C for 15 s and 72°C for 30 s. Amplicons were separated on a 1.5% agarose gel with the HyperLadder™ 100 bp length marker (Bioline) and imaged for analysis using a ChemiDoc MP detection system (Bio-Rad).

Karahoda R., Horackova H., Kastner P., Matthios A., Cerveny L., Kucera R., Kacerovsky M., Tebbens J.D., Bonnin A., Abad C, & Staud F. (2020). Serotonin homeostasis in the materno-foetal interface at term: Role of transporters (SERT/SLC6A4 and OCT3/SLC22A3) and monoamine oxidase A (MAO-A) in uptake and degradation of serotonin by human and rat term placenta. Acta physiologica (Oxford, England), 229(4), e13478.

+ Open protocol

+ Expand

Stability of zot-encoding Prophages

Check if the same lab product or an alternative is used in the 5 most similar protocols

To investigate the stability of the zot-encoding prophages, the V. anguillarum strains PF4, T265 and Ba35 were inoculated from −80°C freezer stocks in MB for 24 h. Then, each culture was serially diluted, spread onto MB agar plates and incubated at room temperature for up to 2 days. After incubation, 50 colonies of each strain were individually inoculated in MB for at least 4 h. Subsequently, the culture was used as a template for PCR, targeting the prophage-related gene, zot, to evaluate the presence of zot-encoding prophages in the individual isolates (Table S1). Conventional PCR analysis was carried out using MyTaq™ Red DNA Polymerase (Bioline, Taunton, MA, USA).

Mauritzen J.J., Castillo D., Tan D., Svenningsen S.L, & Middelboe M. (2020). Beyond Cholera: Characterization of zot-Encoding Filamentous Phages in the Marine Fish Pathogen Vibrio anguillarum. Viruses, 12(7), 730.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!