Absolute sybr green master mix

Total RNA from TAMs was extracted with TRIfast (Peqlab, no. 30-2020) or from MDMs with the NucleoSpin RNA kit (Macherey&Nagel, no. 740955) according to the manufacturer’s instructions. Complementary DNA synthesis was carried out with the iScript cDNA Synthesis Kit (Bio-Rad, no. 170-8891SP) according to the manufacturer’s instructions with 250–500 ng of purified RNA per sample. Quantitative PCR analyses were performed in three technical replicates per sample using ABsolute SYBR Green master mix (Thermo Scientific, no. AB-1158B) in Mx3000p and Mx3005 thermocyclers (Stratagene). The ribosomal protein 27, large subunit (RPL27) transcript was chosen for normalization after testing three housekeeping genes selected from our RNA-seq datasets with eight different TAM samples. RT-qPCR was carried out using the following primers: RPL27, AAAGCTGTCATCGTGAAGAAC and GCTGTCACTTTGCGGGGGTAG; IL12B, GCGAGGTTCTAAGCCATTCG and ACTCCTTGTTGTCCCCTCTG; CXCL10, AAGCAGTTAGCAAGGAAAGGTC and GACATATACTCCATGTAGGGAAGTGA. Raw data were evaluated with the Cy0 method (48 (link)) or the MxPro 4.01 software from Stratagene for Ct value calculation as indicated.

Samples (N = 930) from pediatric (N = 470) and adult (N = 460) patients that met the minimum acceptable criteria for screening, including purity (A260:A280 ratio > 1.70) and concentration (>[100 ng/uL]), were screened in triplicate using validated primers for both oral high-risk strains of HPV (HPV16, HPV18) using Glyceraldehyde-3-Phosphate Dehydrogenase or GAPDH as the positive qPCR control, as previously described [27 (link),28 (link),29 ]. In brief, each reaction was performed using the ABsolute SYBR green mix from ThermoFisher Scientific, which consisted of 2x ABsolute SYBR green master mix (12.5 µL), Forward primer at 10 µM (1.5 µL), Reverse primer at 10 µM (1.5 µL), DNA sample (1.0 ng), and up to 8.0 µL of nuclease-free water. Each reaction was run for 15 min at 95 °C for enzyme activation, followed by 40 cycles of denaturation for 15 s at 95 °C, annealing at the primer-specific temperature for 30 s and extension at 72 °C for an additional 30 s.