For miRNA detection, total RNA was extracted using a TRIzol kit (MDBio Inc., Taipei, Taiwan) and expression of miRNA was analyzed using Mir-X miRNA First-Strand Synthesis and Mir-X miRNA qRT-PCR SYBR kits (Clontech Laboratories, Inc., CA, USA). U6 snRNA was used as the internal control. The specific forward primer of miR-381 was 5′-TATACAAGGGCAAGCTCTCTGT-3′. The U6 forward and reverse primers were 5′-CTCGCTTCGGCAGCACATATACTA-3′ and 5′-ACGAATTTGCGTGTCATCCTTGCG-3′. Results were expressed as Ct values and normalized to calculate the average Ct of each sample (ΔCt), and the relative expression of miR-381 was calculated using the comparative Ct method.
Trizol kit
The TRIzol kit is a reagent used for the isolation and purification of total RNA from various biological samples. It is a single-step method that combines phenol and guanidine isothiocyanate to effectively lyse cells and solubilize cellular components.
Lab products found in correlation
32 protocols using trizol kit
Quantitative Real-Time PCR and miRNA Analysis
For miRNA detection, total RNA was extracted using a TRIzol kit (MDBio Inc., Taipei, Taiwan) and expression of miRNA was analyzed using Mir-X miRNA First-Strand Synthesis and Mir-X miRNA qRT-PCR SYBR kits (Clontech Laboratories, Inc., CA, USA). U6 snRNA was used as the internal control. The specific forward primer of miR-381 was 5′-TATACAAGGGCAAGCTCTCTGT-3′. The U6 forward and reverse primers were 5′-CTCGCTTCGGCAGCACATATACTA-3′ and 5′-ACGAATTTGCGTGTCATCCTTGCG-3′. Results were expressed as Ct values and normalized to calculate the average Ct of each sample (ΔCt), and the relative expression of miR-381 was calculated using the comparative Ct method.
Chondrosarcoma Cell RNA Analysis
For miRNA detection, reverse transcription was performed using Mir-X™ miRNA First-Strand Synthesis and SYBR® RT-qPCR. U6 snRNA was used for normalization. The specific forward primer of miR-519d was as follows: 5′-CAAAGTGCCTCCCTTTAGAGTG-3′. The threshold was set above the non-template control background and within the linear phase of target gene amplification to calculate the cycle number at which the transcript was detected (denoted as CT).
Chondrosarcoma Tissue Collection Protocol
Quantitative Analysis of MMP-9 Expression
Quantitative RT-PCR Analysis of Chondrosarcoma
Quantifying miRNA-196a-3p Expression in Chondrosarcoma Cells
Osteoblastic miRNA Expression Analysis
qPCR Assay for Chondrosarcoma Cells
Quantitative Real-Time PCR Assay for Osteosarcoma
Quantifying Endogenous LIF Expression in Rat Spinal Cord
The specific PCR primers used were as follows: rat GAPDH: sense, GGCAAGTTCAATGGCACAGT; antisense, TGGTGAAGACG CCAGTAGACTC. rat LIF: sense, AGTTGTGCCCCTGCTGTTGG; antisense, GTCACGTTGGGGCCACATAG.
To measure endogenous LIF expression, the L4-L6 spinal cord segments were isolated, and an extraction buffer (#9806, Cell Signaling Technology, MA, USA) was added to the tissue. Samples were homogenized and centrifuged at 4°C. The supernatant was transferred to a fresh tube. Rat LIF concentrations were determined using a specific ELISA kit (SEA085Ra, USCN Life Science Inc., Wuhan, Hubei, PRC).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!