The largest database of trusted experimental protocols

Trizol kit

Manufactured by MDBio
Sourced in Taiwan, Province of China

The TRIzol kit is a reagent used for the isolation and purification of total RNA from various biological samples. It is a single-step method that combines phenol and guanidine isothiocyanate to effectively lyse cells and solubilize cellular components.

Automatically generated - may contain errors

32 protocols using trizol kit

1

Quantitative Real-Time PCR and miRNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The quantitative real-time PCR was carried out using TaqMan one-step PCR Master Mix (Applied Biosystems, CA, USA). Total RNA was extracted using a TRIzol kit (MDBio Inc., Taipei, Taiwan). The cDNA was reverse transcribed using 2 μg of total RNA with an oligo(dT) primer. Each cDNA (100 ng/25μl reaction) sample was mixed with sequence-specific primers and probes according to the manufacturer's instructions. Sequences for all target gene primers and probes were purchased commercially (Applied Biosystems). β-actin was used as the internal control. The cycling conditions consisted of 10 min of polymerase activation at 95 °C, followed by 40 cycles at 95 °C for 15 s and 60 °C for 60 s.
For miRNA detection, total RNA was extracted using a TRIzol kit (MDBio Inc., Taipei, Taiwan) and expression of miRNA was analyzed using Mir-X miRNA First-Strand Synthesis and Mir-X miRNA qRT-PCR SYBR kits (Clontech Laboratories, Inc., CA, USA). U6 snRNA was used as the internal control. The specific forward primer of miR-381 was 5′-TATACAAGGGCAAGCTCTCTGT-3′. The U6 forward and reverse primers were 5′-CTCGCTTCGGCAGCACATATACTA-3′ and 5′-ACGAATTTGCGTGTCATCCTTGCG-3′. Results were expressed as Ct values and normalized to calculate the average Ct of each sample (ΔCt), and the relative expression of miR-381 was calculated using the comparative Ct method.
+ Open protocol
+ Expand
2

Chondrosarcoma Cell RNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from chondrosarcoma cells using a TRIzol kit (MD Bio Inc., Taipei, Taiwan). The reverse transcription reaction was performed using 2 μg of total RNA that was reverse transcribed into cDNA using an oligo(dT) primer. RT-qPCR analysis was carried out using TaqMan® one-step PCR Master Mix (Applied Biosystems, Foster City, CA, USA). Total complementary DNA (100 ng/25 μL reaction) was mixed with sequence-specific primers and TaqMan® probes according to the manufacturer's instructions. Sequences for all target gene primers and probes were purchased commercially (β-actin was used as the internal control) (Applied Biosystems). qPCR assays were carried out in triplicate using a StepOnePlus sequence detection system. The cycling conditions were 10 min of polymerase activation at 95°C, followed by 40 cycles at 95°C for 15 s and 60°C for 60 s.
For miRNA detection, reverse transcription was performed using Mir-X™ miRNA First-Strand Synthesis and SYBR® RT-qPCR. U6 snRNA was used for normalization. The specific forward primer of miR-519d was as follows: 5′-CAAAGTGCCTCCCTTTAGAGTG-3′. The threshold was set above the non-template control background and within the linear phase of target gene amplification to calculate the cycle number at which the transcript was detected (denoted as CT).
+ Open protocol
+ Expand
3

Chondrosarcoma Tissue Collection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The study protocol was approved by China Medical University Hospital’s Institutional Review Board (CMUH 104-REC2-055, CMUH103-REC2-023). Written informed consent was obtained from all study participants prior to study commencement. Tumor tissue specimens were collected from patients with chondrosarcoma undergoing surgical resection procedures and human cartilage tissues were obtained from otherwise healthy OA patients undergoing knee replacement surgery; all procedures were performed in China Medical University Hospital. Total RNA was extracted from tissue using a TRIzol kit (MDBio, Taipei, Taiwan), and all unused human tissue was stored at –80 °C.
+ Open protocol
+ Expand
4

Quantitative Analysis of MMP-9 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
We used a TRIzol kit (MDBio Inc., Taipei, Taiwan) to extract total RNA from chondrosarcoma cells. Next, we synthesized cDNA with an Invitrogen reverse transcription kit (Carlsbad, CA, USA)38 (link). qPCR analysis was performed with the Taqman® One-Step RT-PCR Master Mix (Applied Biosystems, CA, USA). We added 2 μL of cDNA template to each 25 μL reaction using sequence-specific primers and Taqman® probes. GAPDH mRNA expression served as an internal control39 (link). The sequences of the primers were as follows: MMP-9 forward 5’-CACTGTCCACCCCTCAGAGC-3′, and MMP-9 reverse 5’-GCCACTTGTCGGCGATAAGC-3’. GAPDH forward 5′-ACCACAGTCCATGCCATCAC-3′, and GAPDH reverse 5′-TCCACCACCCTGTTGCTGTA-3′.
+ Open protocol
+ Expand
5

Quantitative RT-PCR Analysis of Chondrosarcoma

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from chondrosarcoma cells using a TRIzol kit (MDBio Inc., Taipei, Taiwan). The reverse transcription reaction was performed using 1 μg of total RNA that was reverse transcribed into cDNA using oligo(dT) primers [47 (link)]. Quantitative real-time PCR (qPCR) analysis was carried out using Taqman® One-Step RT-PCR Master Mix (Applied Biosystems, CA). Two microliters of cDNA template was added to each 25-μl reaction with sequence-specific primers and Taqman® probes. Sequences for all target gene primers and probes were purchased commercially. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an endogenous control to normalize expression data (Applied Biosystems). qPCR assays were carried out in triplicate on a StepOnePlus sequence detection system. The cycling conditions were as follows: initial 10-min polymerase activation at 95°C followed by 40 cycles at 95°C for 15 s and 60°C for 60 s. To calculate the cycle number at which the transcript was detected (CT), the threshold was set above the non-template control background and within the linear phase of target gene amplification.
+ Open protocol
+ Expand
6

Quantifying miRNA-196a-3p Expression in Chondrosarcoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
A TRIzol kit (MDBio, Taipei, Taiwan) extracted total RNA and miRNA from the chondrosarcoma cell lines, according to the manufacturer’s instructions, then examined them with a NanoVue Plus spectrophotometer (GE Healthcare Life Sciences; Pittsburgh, PA, USA). Following the manufacturers’ instructions, we reverse-transcribed total RNA into complementary DNA (cDNA) using the M-MLV RT kit (Thermo Fisher Scientific; Waltham, MA, USA) and the Mir-X™ miRNA First-Strand Synthesis kit (Terra Bella Avenue; Mountain View, CA, USA). Quantitative real-time PCR (qRT-PCR) was performed using the miR-196a-3p specific primer. U6 was used as a normalizing control for miRNA qRT-PCR analysis. cDNA samples were subjected to qRT-PCR analysis with SYBR Green, as per our previous reports [27 (link),28 (link)].
+ Open protocol
+ Expand
7

Osteoblastic miRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from osteoblasts with a TRIzol kit (MDBio, Taipei, Taiwan) and miRNAs were quantified using the Mir-X miRNA First-Strand Synthesis Kit (Clontech Laboratories, Palo Alto, CA, USA), as per the manufacturers' protocols. RNA quality and each total RNA sample was examined using the Nanovue Spectrophotometer (GE Healthcare, Pewaukee, WI, USA). Complementary DNA was derived from 1 mg of total RNA using an M-MLV Reverse Transcriptase kit (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's recommendations. Real-time quantitative polymerase chain reaction (qPCR) analysis was carried out with the KAPA SYBR FAST qPCR Kit (Applied Biosystems, Foster City, CA, USA). The cycling conditions were as follows: polymerase activation for 10 min at 95°C followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. Relative normalization of gene expression was performed using endogenous glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the internal control for mRNA or snRNA U6 as the internal control for miRNA. Relative expression levels were calculated using the comparative threshold cycle (CT), defined as the cycle at which the fluorescence becomes detectable above the background fluorescence and is inversely proportional to the logarithm of the initial number of template molecules.
+ Open protocol
+ Expand
8

qPCR Assay for Chondrosarcoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
qPCR assays were performed using the StepOnePlus sequence detection system in accordance with an established protocol 37 (link)-39 . Total RNA was extracted from chondrosarcoma cells using a TRIzol kit (MDBio, Taipei, Taiwan), and cDNA was synthesized using an M-MLV Reverse Transcriptase kit (Invitrogen, Carlsbad, CA, USA). Total cDNA (100 ng) was mixed with sequence-specific primers (Supplementary Table S4) using a KAPA SYBR® FAST qPCR Kit (Applied Biosystems, Foster City, CA, USA).
+ Open protocol
+ Expand
9

Quantitative Real-Time PCR Assay for Osteosarcoma

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from osteosarcoma cells using a TRIzol kit (MDBio Inc., Taipei, Taiwan). The reverse transcription reaction was performed using 2 µg of total RNA that was reverse transcribed into cDNA using an oligo(dT) primer. A volume of 100 ng total cDNA was added per 25-µl reaction, along with sequence-specific primers and Taqman® probes. Sequences for all target gene primers and probes were purchased commercially (β-actin was used as the internal control) (Applied Biosystems, CA). qPCR assays were carried out in triplicate using a StepOnePlus sequence detection system. The cycling conditions were 10 min of polymerase activation at 95°C, followed by 40 cycles at 95°C for 15 s and 60°C for 60 s. The threshold was set above the non-template control background and within the linear phase of target gene amplification to calculate the cycle number at which the transcript was detected (denoted as CT).
+ Open protocol
+ Expand
10

Quantifying Endogenous LIF Expression in Rat Spinal Cord

Check if the same lab product or an alternative is used in the 5 most similar protocols
After behavioural testing, rats were anaesthetized and perfused with saline at different time points. Total RNA was extracted from L4-L6 spinal cord segments using a TRIzol ® kit (MDBio Inc., Taipei, Taiwan). Single-stranded cDNA was synthesized using a two-step MMLV reverse transcriptase system (Promega, Madison, WI, USA). Fifty nanograms of cDNA was mixed with 200 nM specific primers and SYBR ® Green PCR Master Mix (Roche Molecular system, NJ, USA). Quantitative PCR assays were performed in triplicate on a StepOnePlus sequence detection system (Applied Biosystems, CA, USA). The change in gene expression relative to the control was calculated using the 2 -ΔΔCT method.
The specific PCR primers used were as follows: rat GAPDH: sense, GGCAAGTTCAATGGCACAGT; antisense, TGGTGAAGACG CCAGTAGACTC. rat LIF: sense, AGTTGTGCCCCTGCTGTTGG; antisense, GTCACGTTGGGGCCACATAG.
To measure endogenous LIF expression, the L4-L6 spinal cord segments were isolated, and an extraction buffer (#9806, Cell Signaling Technology, MA, USA) was added to the tissue. Samples were homogenized and centrifuged at 4°C. The supernatant was transferred to a fresh tube. Rat LIF concentrations were determined using a specific ELISA kit (SEA085Ra, USCN Life Science Inc., Wuhan, Hubei, PRC).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!