Total RNA was extracted from tissues using a Universal RNA Extraction Kit (Takara Biotech, Dalian, China), and reverse transcription was performed to generate cDNAs using a PrimeScript RT Reagent Kit (Takara Biotech, Dalian, China) according to the manufacturer’s instructions. Relative expression levels of APPV in tissues were determined by real-time quantitative PCR using a DNA Engine 7500 Continuous Fluorescence Detection System (Applied Biosystems, CA, USA) and a SYBR Premix Ex Taq Kit (Takara Biotech, Dalian, China). The specific qPCR primers used were E2-F (GCAGCCGATAAGACAGAG), E2-R (GATAGCCATACACCTTCCCT), β-actin-F (GGTGGGAATGGGTCAGAAGGA), and β-actin-R (TGGCTGGGGTGTTGAAGGTC). Relative expression levels of APPV in tissues were calculated by normalizing the levels of gene transcripts to that of β-actin using a relative standard curve method with the 2−ΔΔCt formula. Statistical analysis was performed using SPSS version 20.0, and the figures were made using GraphPad Prism (GraphPad Software, La Jolla, CA). One-way analysis of variance and Student’s t-test were used to determine the statistical significance of differences in the relative expression levels of APPV in different tissues. Differences were considered statistically significant at P < 0.05.
Dna engine 7500 continuous fluorescence detection system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The DNA Engine 7500 Continuous Fluorescence Detection System is a laboratory instrument designed for real-time quantitative PCR (qPCR) analysis. It provides continuous fluorescence detection capabilities to monitor and analyze DNA amplification during the PCR process.
Automatically generated - may contain errors
3 protocols using dna engine 7500 continuous fluorescence detection system
1
Quantitative Analysis of APPV Expression
2
Quantifying Cytokine Expression in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted, treated, quality determined, stored and reverse-transcribed to cDNA as described in our previous reports [34, 35] . Relative expression levels of IL-1β, IL-6 and TNF-α were determined by real-time PCR using DNA Engine 7500 Continuous Fluorescence Detection System (Applied Biosystems, CA, USA) and SYBR® Premix Ex Taq TM Kit (Takara Biotech, Dalian, China). Primers used for qRT-PCR were designed by Oligo 7 software (Molecular Biology Insights Inc., Cascade, CO, USA), and the sequences for DF-1 cells are as follows: IL-1β-Fwd: ATGACCAAACTGCTGCGGAGG, IL-1β-Rev: GAAGGACTGTGAGCGGGTGTA; IL-6-Fwd: CAAGAAGTTCACCGTG TGCGAGA, IL-6-Rev: ATTCCAGGTAGGTCTGAAAGGCG; TNF-α-Fwd: CTCAGGA CAGCCTATGCCAACA, TNF-α-Rev: CACCACACGACAGCCAAGTCAA; β-actin-Fwd : TGAACTCCCTGATGGTCAGGTC, β-actin-Rev: ACCACAGGACTCCATACCC AAG; Primers for MDCK cells were as follows: IL-1β-Fwd: GTCGAGCCTCATGCCGT GTTC, IL-1β-Rev: GGCAGGCAGCAGACTCAAAGC; IL-6-Fwd: ATGGCTACTGCT TTCCCTACC, IL-6-Rev: CAGTGCCTCTTTGCTGTCTTC; TNF-α-Fwd: ATGAATCCG CCAGCCTACTACAC, TNFα-Rev: CAATCATCTTGTTGCAGGAAGGA-3; β-actin-Fwd: CGACGGGCAGGTCATCACTA, β-actin-Rev: TTCATGGATGCCGCAGGATT. The expression levels for these genes were normalized to that of β-actin, and relative gene expression levels were calculated using the relative standard curve 2 -ΔΔCt method.
3
Quantifying Cytokine Expression in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted, treated, quality determined, stored and reverse-transcribed to cDNA as described in our previous reports [34, 35] . Relative expression levels of IL-1β, IL-6 and TNF-α were determined by real-time PCR using DNA Engine 7500 Continuous Fluorescence Detection System (Applied Biosystems, CA, USA) and SYBR® Premix Ex Taq TM Kit (Takara Biotech, Dalian, China). Primers used for qRT-PCR were designed by Oligo 7 software (Molecular Biology Insights Inc., Cascade, CO, USA), and the sequences for DF-1 cells are as follows: IL-1β-Fwd: ATGACCAAACTGCTGCGGAGG, IL-1β-Rev: GAAGGACTGTGAGCGGGTGTA; IL-6-Fwd: CAAGAAGTTCACCGTG TGCGAGA, IL-6-Rev: ATTCCAGGTAGGTCTGAAAGGCG; TNF-α-Fwd: CTCAGGA CAGCCTATGCCAACA, TNF-α-Rev: CACCACACGACAGCCAAGTCAA; β-actin-Fwd : TGAACTCCCTGATGGTCAGGTC, β-actin-Rev: ACCACAGGACTCCATACCC AAG; Primers for MDCK cells were as follows: IL-1β-Fwd: GTCGAGCCTCATGCCGT GTTC, IL-1β-Rev: GGCAGGCAGCAGACTCAAAGC; IL-6-Fwd: ATGGCTACTGCT TTCCCTACC, IL-6-Rev: CAGTGCCTCTTTGCTGTCTTC; TNF-α-Fwd: ATGAATCCG CCAGCCTACTACAC, TNFα-Rev: CAATCATCTTGTTGCAGGAAGGA-3; β-actin-Fwd: CGACGGGCAGGTCATCACTA, β-actin-Rev: TTCATGGATGCCGCAGGATT. The expression levels for these genes were normalized to that of β-actin, and relative gene expression levels were calculated using the relative standard curve 2 -ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!