Pultra

All cell lines were obtained from ATCC and grown in monolayer at 37 °C/5% CO₂ in Dulbecco’s modified Eagle’s medium (DMEM) or Iscove’s Modified Dulbecco’s Medium (IMDM) supplemented with 10% fetal bovine serum, 0.1 mg/mL penicillin, 100 units/mL streptomycin, and 15 mM Hepes. Generation and characterization of B3-KO and isogenic CRISPR-control cell lines (B3-WT) SW756 and HT3 was described previously^{9 (link)}. In brief, a single-vector lentiviral system was used, driving expression of Cas9 and the gRNA sequence. KO was confirmed by sequencing of the SERPINB3 gene, Western blot showing no protein product, and sequencing of most-likely off-target genes to confirm specificity. SW756-B3-WT/cathepsin L knockout (B3-WT/CTSL-KO) and SW756-B3-KO/cathepsin L knockout (B3-KO/CTSL-KO) lines were derived from SW576 parental and –B3-KO clonal line, respectively, using a CTSL-targeting guide RNA (GTGAGGAATCCTATCCATATG) in exon 5. Knockout was confirmed in the pool cell line by Western blot and next generation sequencing, verifying CTSL indels at a high percentage, resulting in a partial knockout cell line. For the current paper, SiHa and C33A cell lines were engineered to stably express pULTRA (Addgene 24129) mammalian vector driving expression of the wild-type SERPINB3 gene, or SERPINB3 mutant encoding a single alanine to arginine substitution at amino acid 341 (B3-A341R).

TE671 rhabdomyosarcoma cells were obtained from ATCC (LGC, Wesel, Germany) and cultured in complete RPMI medium (10% heat-inactivated fetal calf serum (FCS), 100 units/ml of penicillin and 100 µg/ml of streptomycin; all from Gibco), at 37 °C in 5% carbon dioxide. β, δ, and ε subunits of AChR cloned into pcDNA3.1-hygro, and α subunit cloned into pEGFP-N1 for an intracellular eGFP tag were a gift from David Beeson [20 (link)] and used to transfect TE671 cells to produce TE-AChR-GFP. pCMV3 containing the open reading frame of human CD40 ligand was purchased from Sino Biological. TE cells were stably transfected, sorted for CD40L expression, and irradiated with 72 Gy for mitotic inactivation and kept frozen in liquid nitrogen until use. pUltra was purchased from Addgene (24,129).