RNase H1, either wild type or containing WKKD mutant fragments, in addition to the V5 tag, were PCR amplified from plasmids ppyCAG_RNaseH1_WT (addgene #111906) and ppyCAG_RNaseH1_WKKD (addgene #111905), respectively, and subsequently cloned into the lentivial tetracycline-inducible pLVX-tetOne-Puro plasmid (Clontech, Cat# 631849) using EcoRI and BamHI sites. Different human NR4A1 truncation fragments and the full length NR4A1 were amplified from plasmid pLenti-C-Myc-DDK-P2A-Puro-NR4A1 (Origene, Cat# RC202202L1) and then also cloned into pLVX-tetOne-Puro plasmid (Clontech, Cat# 631849) with EcoRI and BamHI. All the sequences of constructs were validated by Sanger sequencing. Induction of gene expression using doxycline-regulated constructs was confirmed at 48h following drug exposure (1 μg/ml; Clontech).
Plvx tetone puro
Manufactured by Takara Bio
Sourced in United States, Japan
The PLVX-TetOne-Puro is a lentiviral vector that enables doxycycline-inducible expression of a gene of interest in target cells. It contains a tetracycline-responsive promoter element and a puromycin resistance gene for selection of transduced cells.
Automatically generated - may contain errors
Lab products found in correlation
Pspax2, by Addgene (6 mentions)
Pmd2 g, by Addgene (5 mentions)
Polybrene, by Merck Group (5 mentions)
Polybrene, by Santa Cruz Biotechnology (4 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (4 mentions)
Puromycin, by InvivoGen (4 mentions)
Doxycycline, by Merck Group (3 mentions)
Q5 site directed mutagenesis kit, by New England Biolabs (3 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Quikchange lightning site directed mutagenesis kit, by Agilent Technologies (2 mentions)
Pgex 4t 1 vector, by GE Healthcare (2 mentions)
Plhcx, by Takara Bio (2 mentions)
Full length human rnaseh1 cdna, by OriGene (2 mentions)
In fusion hd cloning kit, by Takara Bio (1 mentions)
Facscalibur, by BD (1 mentions)
T4 ligase, by New England Biolabs (1 mentions)
Fast mutagenesis system, by Transgene (1 mentions)
Ant pr 1, by InvivoGen (1 mentions)
Puromycin, by Addgene (1 mentions)
Plvx puro, by Takara Bio (1 mentions)
29 protocols using plvx tetone puro
1
Inducible expression of RNase H1 and NR4A1
2
Inducible Expression Vectors for CDH2 and Cx43
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human CDH2 and Cx43 siRNA and Risc free (control) were purchased from Dharmacon; human cyclin D1 promoter in pGL3-basic (research resource identifiers, RRID:Addgene_32726) and pcDNA 3.2 with Cx43-HA (RRID:Addgene_49851) were obtained from Addgene (which was a donation from Frank McCormick and Anne Brunet laboratory, respectively); pCMV2-CDH2-Flag from Sino Biologicals; and human shRNA pRFP-C-RS with scramble sequence, CDH2-shRNA, or Cx43 shRNA from OriGene Technologies.
Inducible CDH2 and Cx43 expression vectors were created with the lentiviral plasmid pLVX-TetOne-Puro (Takara Bio). The coding region for CDH2 and Cx43 was amplified from pCMV2-CDH2 Flag and pcDNA 3.2-Cx43 HA, respectively, using RT-PCR with following primers: CDH2 forward: 5′-GCA GAG ATC TGG ATC CTC AGT CAT CAC CTC CAC CAT ACA TG-3′, CDH2 reverse: CCC TCG TAA AGA ATT CAT GTG CCG GAT AGC GGG AGC GCTG-3′; Cx43 forward: 5′-CCC TCG TAA AGA ATT CAT GGG TGA CTG GAG CGC C-3′; Cx43 reverse: 5′-GAG GTG GTC TGG ATC CCT AGA TCT CCA GGT CAT CAG GCC-3′. The amplified region was inserted into pLVX-TetOne-Puro using In-Fusion HD Cloning Kit (Takara Bio). The fragment insertion was validated by DNA sequencing at Genewizusing primer: GGATTAGGCAGTAGCTCTGACGGCCC. The complete vector is hereafter referred as pLVX-CDH2/GS and pLVX-Cx43/GS, respectively.
Inducible CDH2 and Cx43 expression vectors were created with the lentiviral plasmid pLVX-TetOne-Puro (Takara Bio). The coding region for CDH2 and Cx43 was amplified from pCMV2-CDH2 Flag and pcDNA 3.2-Cx43 HA, respectively, using RT-PCR with following primers: CDH2 forward: 5′-GCA GAG ATC TGG ATC CTC AGT CAT CAC CTC CAC CAT ACA TG-3′, CDH2 reverse: CCC TCG TAA AGA ATT CAT GTG CCG GAT AGC GGG AGC GCTG-3′; Cx43 forward: 5′-CCC TCG TAA AGA ATT CAT GGG TGA CTG GAG CGC C-3′; Cx43 reverse: 5′-GAG GTG GTC TGG ATC CCT AGA TCT CCA GGT CAT CAG GCC-3′. The amplified region was inserted into pLVX-TetOne-Puro using In-Fusion HD Cloning Kit (Takara Bio). The fragment insertion was validated by DNA sequencing at Genewizusing primer: GGATTAGGCAGTAGCTCTGACGGCCC. The complete vector is hereafter referred as pLVX-CDH2/GS and pLVX-Cx43/GS, respectively.
3
Quantifying Mitochondrial Aging with MitoTimer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MitoTimer transgene was amplified by PCR from the plasmid pTRE-Tight-MitoTimer (Plasmid number 50547, Addgene, MA, USA) using the oligos: CCTGGAGAATTCAGATCTCCAC and GATCCTGATCACTACAGGAACAGGTGGTGGC, and amplicon was cloned into lentiviral construct pLVX-TetOne-Puro (631849, Clontech, CA, USA) by restriction sites EcoRI and BclI. Fibroblasts were infected by packaged lentiviral particles at an approximated MOI of 5–10. Forty-eight hours postinfection, the expression of the transgene was induced with 2 μg/ml of doxycycline during 24 h and then removed from the media to analyze it at different times. On the other hand, after 24 h of doxycycline, cells were treated with CCCP (20 μM) for 24 h and then removed from media to be analyzed. Red and green fluorescence intensity was followed over time by flow cytometry (FACSCalibur, BD Biosciences). Aged mitochondrial quantification was calculated as the percentage of red fluorescence intensity mean at each point with respect to the one of the untreated cells at the beginning of the study (doxycycline removal, 0 h).
4
Cloning and Expression of CRB3 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRB3b was PCR amplified from RNA extracted from MCF10A cells and cloned into the pCMV-Blank vector (Beyotime, Shanghai, China, D2602) using T4 ligase (NEB, MA). Then, the GFP sequence was inserted between the extracellular and transmembrane CRB3 domains to generate the pCMV-CRB3-GFP vector, as described previously (Djuric et al., 2016 (link)). The full-length CRB3 (1–120), CRB3 (1–116), CRB3 (1–83), CRB3 (1–58), and CRB3 (1–26) were amplified by PCR from the pCMV-CRB3-GFP vector using specific primers to create EcoR I and Xho I restriction sites, and then cloned into the pCMV-Blank vector. The full-length was also cloned into the lentiviral vector pLVX-TetOne-Puro (Clontech, Takara, #631849). The plasmid pECMV-3×FLAG-RAB11A was purchased from SinoBiological (Beijing, China). The plasmids of pECMV-3×FLAG-RAB11A[S20V]/[S25N]/[Q70L] mutants were constructed using the Fast Mutagenesis System (Transgen, Beijing, China, FM111-01).
Lentiviruses were produced in HEK293T cells. CRB3-GFP in MCF10A and MCF7 cells were generated using a lentivirus expression system. Stable cell lines were screened using puromycin after lentiviral infection for 72 hr.
Lentiviruses were produced in HEK293T cells. CRB3-GFP in MCF10A and MCF7 cells were generated using a lentivirus expression system. Stable cell lines were screened using puromycin after lentiviral infection for 72 hr.
5
Lentiviral Transduction of HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviruses were used to infect HUVECs. Viruses were collected from HEK293FT cells co-transfected with psPAX2 (Addgene, 12260), pMD2.G (Addgene, 12259) and human N1ICD-V5 inserted into the doxycycline-inducible transfer vector pLVX-TetOne-Puro (Clontech), using the Lipofectamine 2000 transfection reagent (Life Technologies). Viruses were collected 48 and 72 h after transfection, and incubated with HUVECs for 16 h in presence of 8 μg ml−1 polybrene (Santa Cruz). Fresh EBM media containing 1 μg ml−1 puromycin (InvivoGen) was added to select transduced cells.
6
Lentiviral Inducible Expression and CRISPR-Cas9 Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For doxycycline-inducible lentiviral expression of a constitutively nuclear human FOXO1 (FOXO1A3), FLAG-tagged FOXO1A3 was cloned into pLVX-TetOne-Puro (Clontech). For CRISPR–Cas9 genome editing, gene-specific gRNA sequences (Supplementary Table 4 ) were cloned into a plentiCRISPRv2 plasmid co-expressing FLAG-tagged Cas9 nuclease and a puromycin-selection marker (Addgene, 52961). The FUCCI lentiviral reporters mCherry-hCdt1(30/120)-pCSII-EF and mVenus-hGeminin(1/110)-pCSII-EF56 (link) were obtained from the Laboratory for Cell Function Dynamics, CBS, RIKEN, Japan.
Lentivirus production was performed by co-transfection of HEK293FT cells with pMD2.G (Addgene, 12259), psPAX2 (Addgene, 12260) and transfer plasmids, accordingly. Transfections were carried out using Lipofectamine 2000 transfection reagent (Life Technologies) as previously described57 (link). Viruses were collected 48 and 72 h after transfection, filtered through a 0.45-μm filter and incubated with HUVECs for 16 h in the presence of 8 µg ml−1 polybrene (Santa Cruz). After transduction, cells were expanded for 48 h and selected with EBM containing 1 µg ml−1 puromycin (InvivoGen, ant-pr-1).
Lentivirus production was performed by co-transfection of HEK293FT cells with pMD2.G (Addgene, 12259), psPAX2 (Addgene, 12260) and transfer plasmids, accordingly. Transfections were carried out using Lipofectamine 2000 transfection reagent (Life Technologies) as previously described57 (link). Viruses were collected 48 and 72 h after transfection, filtered through a 0.45-μm filter and incubated with HUVECs for 16 h in the presence of 8 µg ml−1 polybrene (Santa Cruz). After transduction, cells were expanded for 48 h and selected with EBM containing 1 µg ml−1 puromycin (InvivoGen, ant-pr-1).
7
Lentiviral Expression of Mitochondrial and Cell Signaling Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentivirus plasmids expressing mitoTimer, FOXO1, and PINK1 were constructed. The mitoTimer and PINK1 were gifts from Roberta Gottlieb (Addgene plasmid, 50547) and Mark Cookson (Addgene plasmid, 13323), respectively. FOXO1 was synthesized in vitro. To avoid the disadvantages caused by a consecutive expression, the coding sequence for each of the three genes was cloned into the tetracycline-induced expression backbone vector (pLVX-TetOne-Puro, Clontech, Otsu, Japan) using incision enzymes EcoR I/BamH I (mitoTimer), Age I/EcoR I (PINK1), and BamH I/BstZ1107 I (FOXO1). The constructed vectors were confirmed by DNA sequencing.
For lentivirus packaging, packaging vectors (psPAX2 and pMD2.G) and expression vectors (pLVX-TetOne-Puro-mitoTimer/FOXO1/PINK1) were cotransfected into 293T cells using FuGene transfection reagents. Titers of the pseudovirus were determined by PCR, and a known titer of the lentivirus was used as the control. Primers targeting the long terminal repeat were used in PCR. A multiplicity of infection (MOI) of 30 was used in all of the experiments. The indicated concentration of DOX was used to induce expression.
For lentivirus packaging, packaging vectors (psPAX2 and pMD2.G) and expression vectors (pLVX-TetOne-Puro-mitoTimer/FOXO1/PINK1) were cotransfected into 293T cells using FuGene transfection reagents. Titers of the pseudovirus were determined by PCR, and a known titer of the lentivirus was used as the control. Primers targeting the long terminal repeat were used in PCR. A multiplicity of infection (MOI) of 30 was used in all of the experiments. The indicated concentration of DOX was used to induce expression.
8
Lentiviral Transduction of HUVECs
9
Lentiviral Overexpression Vector Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Open reading frame of PAGE4 with HA N-terminal tag was cloned into pLVX-TetOne-Puro (Clontech, USA) vector using In-Fusion HD method following the protocol provided by Clontech. Briefly, vector was digested by EcoR I (New England Biolabs, USA) and BamH I for linearization, then mixed with insert DNAs in In-Fusion cloning reaction buffer. Alternatively, open reading frame of CLK2 or HIPK1 with 3X Flag N-terminal tag were amplified from human cDNA library, and then digested by BamH I and Xba I for CLK2, and Xho I and Not I for HIPK1. The insert DNAs were cloned into pLVX-Puro (Clontech) vector. After construction, vectors were transduced into E. coli. Screened clones were expanded, and plasmids were extracted and purified. Then the over-expressing vectors or empty vectors were co-transfected with 2nd Generation Packaging System Mix (Abmgood, Canada) into 293 T cells using calcium phosphate transfection method [21 (link)]. After culturing transfected 293 T cells in DMEM media for 48 h, the supernatant containing lentivirus were harvested and filtered with a 0.45 μm filter (Merck Millipore, Germany).
10
Cellular Starvation and Genetic Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All cells were cultured in DMEM-High glucose (cat. no. ECM0728L, Euroclone) supplemented with 10% FBS (cat. no. ECS0180L, Euroclone), penicillin (100 IU/ml), and streptomycin (100 μg/ml) (cat. no. ECB3001D, Euroclone). For the starvation treatments, cells were washed twice using PBS Ca2+/Mg++ free, and HBSS (14025092, Gibco) supplemented with HEPES (H0887, Euroclone) was added for the indicated time points.
HeLa cells were obtained from ATCC. HeLa-FLCN KO cells were a kind gift of Z. P. Arany. UOK-257 cells were obtained from W. Marston Linehan, MD (The National Cancer Institute, Bethesda). All cell culture incubations were performed at 37 degrees with 5% CO2.
cDNA sequences for overexpression of EGR1 and TFEB were cloned into pLVX-EF1a-PURO and pLVX-TetOne-Puro (Clontech) lentiviral backbones, respectively. For RNA interference, shRNA sequences against EGR1 were cloned in the pLKO.1_hPGK-Puro-CMV-tGFP lentiviral backbone (Sigma-Aldrich).
HeLa cells were obtained from ATCC. HeLa-FLCN KO cells were a kind gift of Z. P. Arany. UOK-257 cells were obtained from W. Marston Linehan, MD (The National Cancer Institute, Bethesda). All cell culture incubations were performed at 37 degrees with 5% CO2.
cDNA sequences for overexpression of EGR1 and TFEB were cloned into pLVX-EF1a-PURO and pLVX-TetOne-Puro (Clontech) lentiviral backbones, respectively. For RNA interference, shRNA sequences against EGR1 were cloned in the pLKO.1_hPGK-Puro-CMV-tGFP lentiviral backbone (Sigma-Aldrich).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!