Relative gene expression of hepatocyte phenotypes was assessed by quantitative real-time PCR. First, hepatocyte sandwich cultures were lysed in an appropriate amount of Trizol reagent (Thermo Fisher Scientific, USA), followed by RNA extraction using a silica column (Zymo Research, USA). Obtained total RNA was then quantified by Biospec-nano microvolume measurement (Shimadzu Scientific, Japan) and converted to complementary DNA with a PrimeScript reverse transcriptase kit (Takara, Japan). Individual primer sequences (Table 3 ) were designed with Primer-BLAST and purchased from Eurofins Genomics. Real-time PCR was performed with KOD SYBR Green chemistry (Takara, Japan) in a StepOnePlus (Applied Biosystems, USA) system, using β-Actin as an internal control. For detailed screening of cellular drug metabolism, RT2 qPCR Rat Drug Metabolism Panels, targeting 84 different related genes, were used with RT2 SYBR Green chemistry (Qiagen, Germany) according to manufacturer's recommendations. Similar to the analysis of individual targets, β-Actin was used as the reference gene.
Primer blast
Manufactured by Eurofins
Sourced in Germany
Primer-BLAST is a tool that helps design specific and efficient primer pairs for PCR amplification. It analyzes input DNA sequences and generates primer sequences that target the specified regions, while ensuring specificity and preventing unwanted cross-reactivity.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Rneasy kit, by Qiagen (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Kod sybr green chemistry, by Takara Bio (1 mentions)
Primescript reverse transcriptase kit, by Takara Bio (1 mentions)
Steponeplus, by Thermo Fisher Scientific (1 mentions)
High capacity reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
7900ht real time pcr system, by Thermo Fisher Scientific (1 mentions)
Illustra rnaspin mini isolation kit, by GE Healthcare (1 mentions)
Icycler iq, by Bio-Rad (1 mentions)
Transcription first strand cdna synthesis kit, by Roche (1 mentions)
7 protocols using primer blast
1
Quantifying Hepatocyte Gene Expression
2
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the RNeasy® kit (Qiagen, Crawley, U.K.) and was eluted using RNase-free water and experiment was performed in accordance with manufacture’s protocol. The High Capacity Reverse Transcription Kit (Applied Biosystems, Life Technologies, UK) was used for the conversion of RNA to cDNA in accordance with manufacturer’s instructions.
Sybr-Green real time quantitative PCR was performed using the 7900HT Real-time PCR system under optimal cycling condition. Primers used for mRNA quantification were designed in-house using Primer-Blast and purchased from Eurofins Genomic (Eurofins Genomic, Ebersberg, Germany). Primer sequences used can be found inSupplementary Table 2 . Validation of microarray studies was carried out using RNA matched samples to those used for hybridisation to the Affymetrix arrays.
Gene expression is shown as fold change of the control treatment and normalised to the endogenous controls. The Ct value for each gene was normalised to β-Actin and 18S endogenous controls (ΔCt), ΔCt was then normalised to the treatment control (ΔΔCt), and the ΔΔCt was used to calculate gene expression changes as a fold change over control.
Sybr-Green real time quantitative PCR was performed using the 7900HT Real-time PCR system under optimal cycling condition. Primers used for mRNA quantification were designed in-house using Primer-Blast and purchased from Eurofins Genomic (Eurofins Genomic, Ebersberg, Germany). Primer sequences used can be found in
Gene expression is shown as fold change of the control treatment and normalised to the endogenous controls. The Ct value for each gene was normalised to β-Actin and 18S endogenous controls (ΔCt), ΔCt was then normalised to the treatment control (ΔΔCt), and the ΔΔCt was used to calculate gene expression changes as a fold change over control.
3
Rapid NDM-1 Gene Screening Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The primer used in the study was designed using reference nucleotide sequences for NDM-1 in GenBank under accession number FN396876.1 (Klebsiella pneumoniae plasmid pKpANDM-1 sequence carrying new Metallo-beta-lactamase gene NDM-1, isolate KP-05-506). Using Primer-BLAST, a specific primer pair was designed on the target sequence and then commercially synthesized by Eurofins Genomics India Pvt Ltd. The designed primer sequence consists of forwarding primer 5′-GTACTGGCGTAACCCTTCACA -3′ and the reverse primer 5′-CATTCATGGCGGGCAGGATAA -3′ for amplification of a sequence of 121 base pair for screening and quantification of the NDM-1 gene. The Primer-BLAST analysis was used to check the specificity of the designed primer (http://www.ncbi.nlm.nih.gov). BLASTN analysis of the designed primers for the real-time qPCR assay revealed a 100% homogeneity with the NDM-1-encoding gene only.
4
Real-Time PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the RNeasy Kit (Qiagen) as described by the manufacturer's protocols and reverse transcribed using the High-Capacity cDNA reverse transcription kit (Applied Biosystems, Life Technologies, UK).
SYBR Green real time quantitative PCR was performed using the 7900HT Real-time PCR system under optimal cycling conditions. Primers used for mRNA quantification were designed in-house using Primer-Blast and purchased from Eurofins Genomic (Eurofins Genomic, Ebersberg, Germany). Primer sequences used can be found inSupplementary Table 3 . Validation of microarray studies was carried out using RNA matched samples to those used for hybridisation to the Affymetrix arrays.
Gene expression is shown as fold change of the control treatment and normalised to the endogenous controls. The Ct value for each gene was normalised to β-Actin and 18S endogenous controls (ΔCt), ΔCt was then normalised to the treatment control (ΔΔCt), and the ΔΔCt was used to calculate gene expression changes as a fold change over control.
SYBR Green real time quantitative PCR was performed using the 7900HT Real-time PCR system under optimal cycling conditions. Primers used for mRNA quantification were designed in-house using Primer-Blast and purchased from Eurofins Genomic (Eurofins Genomic, Ebersberg, Germany). Primer sequences used can be found in
Gene expression is shown as fold change of the control treatment and normalised to the endogenous controls. The Ct value for each gene was normalised to β-Actin and 18S endogenous controls (ΔCt), ΔCt was then normalised to the treatment control (ΔΔCt), and the ΔΔCt was used to calculate gene expression changes as a fold change over control.
5
RNA Isolation and qRT-PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from total protein lysates with TRIzol® reagent (Life Technologies, Karlsbad, CA, USA) as described previously [34 (link)]. Oligonucleotides (Table S2 ) were self-designed using Primer-BLAST [35 (link)] and synthesized by Eurofins Genomics (Ebersberg, Germany). Efficiencies of all self-designed primers were calculated with known cDNA concentrations. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and succinate dehydrogenase complex subunit A (SDHA) were used as housekeeping genes. Relative gene expression was calculated using the 2∆∆CT analysis method [36 (link)].
6
Quantitative RT-PCR for Neuronal C5aR1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cortical neuronal cultures was extracted using the Illustra RNAspin mini isolation kit (GE Healthcare). cDNA synthesis was performed using Superscript III reverse transcriptase following manufacturer's instructions. Quantitative RT-PCR was performed using the iCycler iQ and the iQ5 software (Bio-Rad) using SYBR/Green Master Mix. Mouse C5aR1 and HPRT primers were designed using primer-blast (ncbi.nlm.nih.gov) and obtained from Eurofins (Louisville, KY): C5aR1: Forward 5′-3′: GGGATGTTGCAGCCCTTATCA; Reverse 5′-3′: CGCCAGATTCAGAAACCAGATG. HPRT: Forward 5′-3′: AGCCTAAGATGAGCGCAAGT; Reverse 5′-3′: ATCAAAAGTCTGGGGACGCA. Quantitative RT-PCR data were only accepted if detected below 40 cycles of amplification.
7
Platelet RNA Isolation and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Thermo Fisher Scientific Inc., Waltham, Massachusetts, USA) was used according to manufacturers protocol to isolate RNA from purified platelets. After isolation RNA quantity was measured using full-spectrum, UV-Vis spectrophotometer (NanoDrop 2000, Thermo Fisher Scientific Inc., Waltham, Massachusetts, USA) and diluted to match 1ug/ ul.
Transcription First Strand cDNA Synthesis Kit (Roche Applied Science, 82377 Penzberg Bavaria, Germany) was used to generate cDNA from respectively 1ug RNA according to manufacturers guidelines. All primers were designed using Primer-Blast and acquired from Eurofins (Eurofins Genomics GmbH Ebersberg Germany). The sequences of the primers were as follows (forward, reverse):GGGTTGAAGCACTGGACAAT , CAGAGAAGCCTGATTGGAGG for TLR-2; TGAGCAGTCGTGCTGGTATC , CAGGGCTTTTCTGAGTCGTC for TLR-4; ACAACAACATCCACAGCCAA , CTCAGGCCTTGGAAGAAGTG for TLR-9; CTC GCC TTT GCC GAT CCG CC , ACA TGC CGG AGC CGT TGT CG for b-Actin;
Transcription First Strand cDNA Synthesis Kit (Roche Applied Science, 82377 Penzberg Bavaria, Germany) was used to generate cDNA from respectively 1ug RNA according to manufacturers guidelines. All primers were designed using Primer-Blast and acquired from Eurofins (Eurofins Genomics GmbH Ebersberg Germany). The sequences of the primers were as follows (forward, reverse):
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!