Quantstudio 7 flex real time system

The total RNA from THP-1 cells was extracted with the mirVana™ miRNA isolation kit (AMBION, catalog AM1561) and subsequently converted to cDNA using the RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific, catalog K1631). qPCR was done using the Syber green mix (Bio-Rad, catalog 172-5124) and run in a QuantStudio 7 Flex Real-Time system (Applied Biosystems, catalog 448598). Primer sequences to determine KD levels of TRAFD1 were 5′ GCTGTTAAAGAAGCATGAGGAGAC and 3′ TTGCCACATAGTTCCGTCCG. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as endogenous qPCR control with primers 5′ ATGGGGAAGGTGAAGGTCG and 3′ GGGGTCATTGATGGCAACAATA. Relative expression values of TRAFD1 were normalized to the endogenous control GAPDH and calculated using the ΔΔCT method, then given as a percentage relative to SCR expression levels.

A total of 500 ng of total blood RNA was used for reverse transcription polymerase chain reaction (RT-PCR), using the high-capacity complementary DNA Transcription Kit with random primers (Applied Biosystems). Quantitative real-time PCR (qRT-PCR) was performed using SYBR GreenER qPCR SuperMix (Invitrogen). Samples were run in triplicate, and qRT-PCRs were run on a QuantStudio 7 Flex Real-Time system (Applied Biosystems).
List of primers and their sequences in this study:
Primers targeting the novel RNA-dependent RNA polymerase (RDRP) contig from our study

RDRP forward 5′-GCTGTCAAATCGGTTTCCAAC-3′;

RDRP reverse 5′-CTGCCTTCGTCATCTTGGAG-3′.

Primers targeting highly expressed control regions

GAPDH forward 5′-GTTCGACAGTCAGCCGCATC-3′;

GAPDH reverse 5′-GGAATTTGCCATGGGTGGA-3′.

Total RNA was extracted from different samples using the Hipure plant RNA purification kit (Magen Biotech, China), following the manufacturer’s instructions. One microgram of high-quality RNA was used to synthesize the first strand of cDNA using TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, China). qRT-PCR was performed in the 10-µL reaction mixture comprising 5 µL of SYBR^® Premix Ex Taq™ II mix (Takara, Dalian, China), 0.3 µL of primer (forward and reverse each; the final concentration of 10 µM), 3.9 µL of ddH₂O, and 0.5 µL of cDNA template with a final concentration of 300 ng/µL. The reactions were carried out using a Quant studio 7 flex real-time system (Applied Biosystems Life Technologies, New York), following the manufacturer’s protocol. The reaction was started with an initial incubation at 50 °C for 2 min and 95 °C for 5 min, then subjected to 40 cycles of 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 20 s. qRT-PCR was performed in three biological replicates, and each biological replicate consisted of three technical replicates. Moreover, β-actin was used as a housekeeping gene to normalize the relative expression of target genes. Relative gene expression was analyzed following the 2^–ΔΔCT method [37 (link)].