Mirna first strand cdna kit

Manufactured by Tiangen Biotech

Sourced in China

The MiRNA First-Strand cDNA Kit is a laboratory product designed for the reverse transcription of miRNA (microRNA) to cDNA. It provides the necessary components and protocols for the efficient conversion of miRNA to complementary DNA (cDNA) for further analysis and applications.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (3 mentions) Mirna qpcr kit, by Tiangen Biotech (3 mentions) Reverse transcription system kit, by Takara Bio (2 mentions) Mircute plus mirna qpcr kit, by Tiangen Biotech (2 mentions) Nanodrop, by Thermo Fisher Scientific (2 mentions) Sybr mixture, by Takara Bio (1 mentions) Primescript rt kit, by Takara Bio (1 mentions) Trizol reagent, by Beyotime (1 mentions) Sybr green pcr kit, by Toyobo (1 mentions) Quantstudio 3, by Tiangen Biotech (1 mentions) Trizol, by Tiangen Biotech (1 mentions) Mircute serum plasma mirna isolation kit, by Tiangen Biotech (1 mentions) Revertaid first strand cdna kit, by Thermo Fisher Scientific (1 mentions) Sybr green pcr kit, by Qiagen (1 mentions) Sybr green pcr kit, by Takara Bio (1 mentions) Aceq sybr qpcr master mix, by Vazyme (1 mentions) Mirna isolation kit, by Tiangen Biotech (1 mentions) Lightcycler 96, by Roche (1 mentions) Hiscript 2 qrt supermix 2, by Vazyme (1 mentions)

6 protocols using mirna first strand cdna kit

Quantitative Analysis of Circular RNA and mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

First, total RNA was isolated using TRIzol reagent (Beyotime). Then, total RNA was reverse assembled into cDNA with the use of a PrimeScript RT kit (Takara) or miRNA First‐Strand cDNA kit (Tiangen) in accordance with the manufacturer's protocols. Finally, SYBR mixture (Takara) was applied for cDNA quantification. In this study, β‐actin or U6 acted as an internal reference, and relative expression was processed via the 2^−ΔΔCT method. Primers are listed below:
Circ‐PDZD8, F: 5′‐ACATGACCAGCTTACGTTGA‐3′ and R: 5′‐ATAAGTCGATCTCCCCGCTG‐3′; PDZD8, F: 5′‐CTTCGGGAGCGTCTGAGGAG‐3′ and R: 5′‐CATTTTGAGGACATCGGGCG‐3′; miR‐330‐5p, F: 5′‐GCCTCTCTGGGCCTGTGTC‐3′ and R: 5′‐CAGTGCAGGGTCCGAGGTAT‐3′; LARP1, F: 5′‐ACTCCATGCTTTGGAGGGTG‐3′ and R: 5′‐AGGTATGGGAGCCTCTTGGA‐3′; U6, F: 5′‐CGCTTCGGCAGCACATATAC‐3′ and R: 5′‐TTCACGAATTTGCGTGTCAT‐3′; β‐actin, F: 5′‐CCATGTACGTTGCTATCCAG‐3′ and R: 5′‐CTTCATGAGGTAGTCAGTCAG‐3′.

Zhu X., Du T., Chen X, & Hu P. (2023). Circ‐PDZD8 promotes cell growth and glutamine metabolism in non‐small cell lung cancer by enriching LARP1 via sequestering miR‐330‐5p. Thoracic Cancer, 14(22), 2187-2197.

+ Open protocol

+ Expand

RNA Isolation and Quantification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol reagent (Invitrogen) was used to extract the total RNA from tissues and cells according to a modified version of the manufacturer’s protocol. The reverse transcription of lincRNA and mRNA was completed using a reverse-transcription system kit (Takara, Otsu, Japan) and assayed by qPCR using a standard SYBR Green PCR kit (Toyobo Life Science, Osaka, Japan) according to the manufacturers' protocols with GAPDH as the endogenous control to measure mRNA levels. Reverse transcription of miRNA was performed using an miRNA First-Strand cDNA Kit (TIANGEN, Beijing, China) and assayed by qPCR using an miRcute Plus miRNA qPCR Kit (TIANGEN, Beijing, China) with U6 as the endogenous control for miRNA expression. Relative quantification was performed using the comparative CT (2^-ΔΔCT) method. Each assay was repeated three times, independently of each other.

Zhang H., Liao Z., Liu F., Su C., Zhu H., Li Y., Tao R., Liang H., Zhang B, & Zhang X. (2019). Long noncoding RNA HULC promotes hepatocellular carcinoma progression. Aging (Albany NY), 11(20), 9111-9127.

+ Open protocol

+ Expand

Differential miRNA Expression in Chicken Growth

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We re-selected 6 fast- and slow-growing Jinghai yellow chickens (3 slow-growing chickens and 3 fast-growing chickens) to collected leg muscles. Total RNAs were isolated with Trizol (TIANGEN, Beijing, China) and miRNAs were reverse transcribed into cDNA with the miRNA First-Strand cDNA kit (TIANGEN, Beijing, China). The forward primers used for quantification in the study were designed using Primer 5.0 and U6 small nuclear RNA (U6) was used for the housekeeping gene. The qPCR was conducted on QuantStudio 3 with the miRNA qPCR kit (TIANGEN, Beijing, China), and the reverse primers also came from the qPCR kit. The relative expression of miRNAs was calculated using the 2^−ΔΔCT method (Rao et al., 2013 (link)).

Wu P., He M., Zhang X., Zhou K., Zhang T., Xie K., Dai G., Wang J., Wang X, & Zhang G. (2022). miRNA-seq analysis in skeletal muscle of chicken and function exploration of miR-24-3p. Poultry Science, 101(11), 102120.

+ Open protocol

+ Expand

Comprehensive RNA Extraction and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells and tissues using TRIzol reagent (Invitrogen), according to the manufacturer's instructions. miRNA was extracted from the serum using the miRcute serum/plasma miRNA isolation kit (TIANGEN), according to the manufacturer's protocol. U6 and GAPDH were used as endogenous controls to normalize miRNA and mRNA, respectively. mRNA and miRNA were then reverse transcribed to complementary DNA (cDNA) using the Revert Aid First‐Strand cDNA kit (Thermo Scientific) and miRNA First‐Strand cDNA kit (TIANGEN), respectively, according to the manufacturer's protocols. qRT‐PCR was performed in triplicate on the Rotor‐Gene Q MDx detection system (QIAGEN) using the SYBR Green PCR kit (QIAGEN) and miRNA qPCR kit (TIANGEN) to detect mRNA and miRNA, respectively. Relative changes in the expression levels of the mRNA and miRNA were quantified using the 2^−ΔΔCT method. All primers used in our study were as follows: MOB1B forward, 5′‐TTCGGATGGCT GTCATGCTTCC‐3′, reverse, 5′‐GCTGACA TCACTGGACAACTCTC‐3′; CCND1 forward, 5′‐TCTACACCGACAACTCCATCCG‐3′, reverse, 5′‐TCTGGCATTTTGG AGAGGAAGTG‐3′; XIAP forward, 5′‐TGGCAGATTATGAAGCACGGATC‐3′, reverse, 5′‐AGTTAGCCCTCCTCCACAGTGA‐3′; GAPDH forward, 5′‐GGTGGTC TCCTCTGACTTCAA‐3′, reverse, 5′‐TCTTCC TCTTGTGCTCTTGCT‐3′.

Pang H., Wang J., Wei Q., Liu J., Chu X., Yuan C., Yang B., Li M., Ma D., Tang Y., Wang C, & Zhang J. (2022). miR‐548ag functions as an oncogene by suppressing MOB1B in the development of obesity‐related endometrial cancer. Cancer Science, 114(4), 1507-1518.

+ Open protocol

+ Expand

Quantitative Analysis of lncRNA and miRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol reagent (Invitrogen) was used for the extraction of total RNA. Utilizing reverse-transcription system kit (Takara, Otsu, Japan), the total RNA was reverse transcribed into cDNA, and qPCR analysis was carried out by the standard SYBR Green PCR kit (Takara). Through a miRNA First-Strand cDNA Kit (TIANGEN, Beijing, China), the reverse transcription of miRNA was performed, and qPCR analysis was conducted with miRcute Plus miRNA qPCR Kit (Tiangen) Relative quantification analysis was carried out by 2^−ΔΔCT method. GAPDH (for lncRNA analysis) or U6 (for miRNA expression analysis) was taken as the negative control. The primers were as follows: SNHG22 forward, 5ʹ-AGGAGAGCTGCTCTTCACAGG-3ʹ and reverse, 5ʹ-TCCTAGGCTGAGTGTGTCTCC-3ʹ; miR-16-5p forward, 5ʹ-GGAAGATGAGGAGGTCGCTG-3ʹ and reverse, 5ʹ-GACTTGACTGGAAGGGTGGG-3ʹ; GAPDH forward, 5ʹ-CCTGGCACCCAGCACAAT-3ʹ and reverse, 5ʹ-GGGCCGGACTCGTCATCG-3ʹ, U6 forward, 5ʹ-GATTTCTCCCTCATCGCTTACAG-3ʹ and reverse, 5ʹ-CTGCTTCATGATCGTTGTTGCTTG-3ʹ.

Zhang Y., Lu C, & Cui H. (2021). Long non-coding RNA SNHG22 facilitates hepatocellular carcinoma tumorigenesis and angiogenesis via DNA methylation of microRNA miR-16-5p. Bioengineered, 12(1), 7446-7458.

+ Open protocol

+ Expand

Zebrafish Embryo Microrna Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

On the night before spawning, the paired adult zebrafish are placed separately on both sides of the breeding tank, and the divider is opened at 8:30 a.m. on the spawning day to start mating. One-cell stage embryos were placed on a fluted agarose plate containing a small amount of EM solution. Approximately 1 nL of the mix solution or mRNA was injected per embryo.
Total miRNA was isolated from the 4 dpf (day post fertilization) larvae which expressed red fluorescence using the miRNA Isolation Kit (Tiangen, DP501, China), according to the manufacturer’s protocols. RNA concentration was measured by Nanodrop (Thermo Scientific, Waltham, USA). 1 μg miRNA was reversely transcribed into cDNA with miRNA First-Strand cDNA Kit (Tiangen, KR211, China) and cDNA was quantified by qPCR system (Light-Cycler 96, Roche) with miRNA qPCR Kit (Tiangen, FP411, China).To detect RNA levels, 4 dpf larvae with red fluorescence were selected to isolate total RNA using TRIzol (TARAKA, China), and the RNA was reverse-transcribed into cDNA with HiScript II qRT SuperMix II (Vazyme, China). The mRNA expression levels were quantified by the qPCR system using AceQ qPCR SYBR Master Mix (Vazyme, China). Twenty-five larvae were collected for each experimental condition. Each experiment was repeated three times in biology and technology. The qPCR primers used are listed in the Supplementary Table S1.

Shen Y., Chen X., Song Z., Yao H., Han A., Zhang Y., Cai Y, & Hu B. (2024). MicroRNA-9 promotes axon regeneration of mauthner-cell in zebrafish via her6/ calcium activity pathway. Cellular and Molecular Life Sciences: CMLS, 81(1), 104.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!