Anti histone 3

Tissues containing ischemic penumbra were harvested for Western blotting at 24, 48, 72 h after MCAO following a standard protocol (Molecular Clone, Edition II). Briefly, the tissues were lysed in 300 μL lysis buffer (10 mM Tris, 150 mM NaCl, 1 % Triton X-100, 0.5 % NP-40, 1 mM EDTA, pH 7.4) and mixed with protease and phosphatase inhibitor cocktails (Roche). Nuclear protein was obtained using nuclear and cytoplasmic extraction reagents (Thermo Scientific). Twenty-five micrograms of cell lysate, as quantified with a BCA protein assay (Pierce), was separated on SDS-PAGE and transferred to PVDF membranes (Roche). The primary antibodies used were as follows: anti-glial fibrillary acidic protein (GFAP) (1:4000, Cell Signaling Technology), anti-Iba1 (1:1000, Abcam), anti-DRD2 (1:2000, Abcam), anti-p-STAT3 (Tyr705) (1:1000, Cell Signaling Technology), anti-STAT3 (1:1000, Cell Signaling Technology), anti-CRYAB (1:2000, Abcam), anti-β-actin (1:2000, Abcam), and anti-histone 3 (1:2000, Cell Signaling Technology). The secondary HRP-labeled antibodies were all from Cell Signaling Technology. Chemical reactions were detected with an ECL system (Advansta), and the scanned images were analyzed with ImageJ software (version 1.47). The protocols for cell culture experiments were the same as those described above.

Cell pellets with 5 × 10⁶ MΦN or MΦP were resuspended in a cold cytoplasmic-lysing buffer (10 mM HEPES pH 7.9, 1.5 mM MgCl₂, 10 mM KCl, 0.5 mM DTT, 0.5% Igepal, and EDTA-complete protease inhibitor cocktail) and incubated (15 min; on ice). After centrifugation (3500 rpm; 4 °C; 15 min), each supernatant, which contained predominantly cytoplasmic proteins, was collected. Each remaining pellet was washed two times and resuspended in nuclei-lysing buffer (5 mM HEPES pH 7.9, 1.5 mM MgCl₂, 0.2 mM EDTA, 0.5 mM DTT, 25% glycerol and EDTA-free complete protease inhibitor cocktail) and incubated (4 °C; 25 min) with rocking agitation. Each supernatant, which contained predominantly total nuclear proteins, was collected after centrifugation (13,000 rpm; 4 °C; 5 min). Analysis of protein (20 μg) from cytoplasmic or nuclear cellular fractions was performed by western blot, as described above, using the antibodies anti-p-IRF3, anti-β-tubulin, and the polyclonal anti-Histone-3 (Cell Signaling), each at 1:1000 dilution.

The following primer sequences were used: OGT forward: CAGCATCCCAGCTCACTT, reverse: CAGCTTCACAGCTATGTCTTC; HES1 forward: ACGTGCGAGGGCGTTAATAC, reverse: GGGGTAGGTCATGGCATTGA; OGA forward: CGAGTGAACATTCCCATCACT, reverse: CCCAAAGGAGCACAGATGTT; PTEN forward: CGAACTGGTGTAATGATATGT, reverse: CATGAACTTGTCTTCCCGT.
The following antibodies from Cell Signaling Technology (Danvers, MA) were used: anti-OGT (#5368), anti-HES1 (#11988), anti-phospho-Ser235/236-S6 (#4858), anti-γ-H2AX (#9718), anti-PARP (#9542), and anti-Histone 3 (#4499). Mouse-derived anti-O-Linked N-Acetylglucosamine (RL2) (ab2739) was acquired from Abcam (Cambridge, UK). Mouse anti-α-tubulin (#CP06) was from Merck Millipore (Burlington, MA).
The following chemical compounds were used: OSMI1 compound was kindly provided by Professor Suzanne Walker (Harvard Medical School). Additional OSMI1 compound was purchased from Sigma Aldrich (SML1621). Efficacy of the two OSMI1 stocks was determined to be similar (data not shown); O-GlcNAcase inhibitor PUGNAc (A7229), MG132 proteasome inhibitor (M7449), mTORC1 inhibitor Everolimus (Ev) (SML2282) and PR inhibitor mifepristone (MF) (M8046), were purchased from Sigma Aldrich. γ-secretase inhibitor (GSI) RO4929097 was purchased from Selleckchem (S1575).

The lentiviral constructs were used to transfect the TSCC cell lines; 2 weeks later, the cells were selected via selection pressure using puromycin. The RIPA lysis buffer (Beyotime Biotechnology, Shanghai, China) and Complete Lysis‐M reagent (Roche, USA) were used to prepare the nuclear extracts or whole cell lysates. Later, the protein concentrations were measured through the BCA assay (ThermoFisher Scientific, Waltham, MA). Afterwards, proteins would be isolated through 10% SDS‐PAGE, followed by transfer to the PVDF membranes. The anti‐SOX8, anti‐GOLPH3, anti‐TFAP2A, anti‐Histone3, anti‐p‐PI3K, anti‐PI3K, anti‐p‐AKT, anti‐AKT, anti‐p‐GSK3β, anti‐GSK3β, anti‐FOXO1, anti‐p‐FOXO1, anti‐β‐catenin, anti‐N‐cadherin, anti‐E‐cadherin, anti‐Snail, anti‐Vimentin, and anti‐GAPDH antibodies were provided by Cell Signaling Technology (Danvers, MA). Meanwhile, the anti‐c‐Myc rabbit antibodies were provided by Abcam (Cambridge, UK).

In 10-cm dishes, 293T (HEK 293T) cells (American Type Culture Collection) were cultured according to the manufacturer’s instructions until confluent. Cells were pretreated for 15 min with 1% hydroxypropyl-β-cyclodextrin (HPCD) in DMEM containing 1% delipidated serum. HPCD was removed, and cells were treated with 30 μM cSN50.1 or cSN50.1α in DMEM containing 5% delipidated serum for 2 h (see (9 (link)) for details) Nuclear extracts were obtained as described above. HPCD-stimulated cells not treated with peptide and unstimulated cells served as positive and negative controls, respectively.
The nuclear content of NF-κB RelA in RAW cells or SREBP2 in HEK 293T cells was determined by quantitative immunoblotting using rabbit polyclonal anti-NF-κB RelA (Abcam) or rabbit polyclonal anti–SREBP2 (Invitrogen), respectively. Rabbit monoclonal anti-Histone 3 (Cell Signaling Technology) was used to measure Histone 3 as a nuclear loading control for normalization. Immunoblots were analyzed on a LI-COR Biosciences Odyssey Infrared Imaging System.

Cells were lysed in RIPA buffer (25 mM TrisHCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) supplemented with protease inhibitors. Protein samples were separated by SDS-PAGE and transferred to a nitrocellulose membrane. Membranes were blocked in 5% non-fat dry milk and incubated in primary antibody overnight at 4°C, followed by horseradish peroxidase-conjugated anti-mouse or anti-rabbit secondary antibodies (Invitrogen). Antibody-protein complexes were detected with ECL Plus (Amersham Biosciences) and exposed to chemiluminescent film. Primary antibodies: mouse anti-β-catenin (Santa Cruz Biotechnology; 1:500 dilution), mouse anti-β-actin (Abcam; 1:5,000), mouse anti-γ-tubulin (Abcam; 1:1000), anti-Histone 3 (Cell Signaling; 1:1000). Densitometric analysis was performed using ImageJ software (National Institutes of Health, Bethesda, MD).