Psicor

The CD105(+) ACHN kidney cancer cell subpopulation is isolated and maintained as previously reported [9 (link)]. The shRNA plasmids for CD105 knockdown were constructed from pSicoR (Addgene, #11579) with target sequences of shENG1: 5′-GAAAGAGCTTGTTGCGCAT-3′ and shENG2: 5′-AACAGTCCATTGTGACCTTCA-3′, as previously reported [9 (link)]. Data presented were from knockdown with shEGN1, which is consistent with the results from shENG2. The ectopic overexpression plasmids of CDA, MYC, and NANOG were constructed based on the basic lentiviral vector modified from pSicoR (Addgene, #11579). Also, the labeling of EGFP or RFP in the cells for transwell assay was made by transfection of lentivirus from EGFP- or RFP-expressing plasmid with pSicoR (Addgene, #11579) backbone. 293T cells were purchased from ATCC.
For antibodies, anti-human C-myc (ab32072), E-cadherin (ab1416), and N-Cadherin (ab19348) antibodies were bought from Abcam (MA, USA); anti-human β-actin (AC026) antibody was bought from ABclonal (MA, USA); anti-human CD105(7508-1) and vimentin (2707-1) antibody were bought from Epitomics (CA, USA); and anti-human MHC-I (1913-1) were bought from Genetex (CA, USA). For flow cytometry antibodies, anti-human CD105 (130-112-321) conjugated with PE antibody was bought from Miltenyi (CA, USA) and was used for regular verification of CD105 expression in CD105(+) cell within 50 passages.

Target fragments were inserted into lentiviral vectors such as pCDH-MSCV-MCS-EF1-copGFP (System biosciences, USA) and pSiCOR (Addgene, #11597), all plasmids were verified by DNA sequencing. Together with pGC-LV, pHelper 1.0, and pHelper 2.0 plasmids, recombinant lentiviral vectors were transfected into HEK293 cells, in which recombinant lentivirus was generated. Target cells were infected with lentivirus, then treated with puromycin for 14 days. After the efficiency of overexpression or depletion plasmids was confirmed, surviving cells were used for further experiments.

miR-223-3p overexpression vector pLVX-IRES-ZsGreen1 (miR223-3p sequence: 5′-TCTGGCCTTCTGCAGTGTTACGCTCCGTGTATTTGACAAGCTGAGTTGGACACTCTGTGTGGTAGAGTGTCAGTTTGTCAAATACCCCAAGTGTGGCTCATGCTTATCAG-3′) and interference vector pSICOR (sequence: 5′-TGTCAGTTTGTGAAATACCCC-3′) were purchased from Addgene (Cambridge, MA, USA). T293 cells were seeded in T25 petri dishes, and when they reached 70–80% confluence, they were transfected with pLVX-IRES-ZsGreen1-miR-223-3p or pSICOR-shmiR-223-3p using Lipofectamine 2000 (Invitrogen, CA, USA) following the manufacturer's instruction. Virus titer was determined by immunofluorescence.