Pglvh1 gfp puro vector

The full-length complementary cDNAs of human SATB2, WDR5 and GADD45A were synthesized and cloned into the expression vector pcDNA3.1 (Invitrogen, China). The small hairpin RNA (shRNA) of SATB2-AS1 was synthesized and cloned into the pGLVH1/GFP/Puro vector (GenePharma, China). SATB2-AS1 siRNAs were designed and synthesized by Ambion (USA). The plasmid vectors and siRNAs were transfected into CRC cells using Lipofectamine 3000 (Invitrogen, USA) according to the protocol. All siRNA and shRNA sequences are listed in Additional file 1: Table S1.

The human shRNA sequences specifically targeting PKN2 (PKN2 shRNA#1: 5′- CCGGTACTTTGGAAGTTCGTCTTATCTCGAGATAAGACGAACTTCCAGTATTTTTG-3′; PKN2 shRNA#2: 5′-CCGGGCAGGAATTAAATGCACATATCTCGA.
GATATGTGCATTTAATTCCTGCTTTTT -3′) were cloned into pGLVH1/ GFP + Puro vector (Genepharma). The expression construct of PKN2-WT (human) was generated by ligating full-length ORF of wild type PKN2 (1-936aa, Homo sapiens) and cloned into pGLV3/H1/GFP + Puro vector (Genepharma). PKN2-K686R mutant (human) was created with a dominant negative (DN)(K686R) point mutation at the ATP binding site. Lentivirus was produced and collected after plasmid transfection of 293 T cells. HT-29 and SW480 cells were transduced with PKN2 shRNA or scramble shRNA (shCTL) lentivirus expressing GFP. SW480 and HCT116 cells were infected with PKN2-WT (human), PKN2-K686R or control(Vector) lentivirus. Stable cell lines were selected by puromycin treatment (2 μg/ml) for 2 weeks. Knockdown or overexpression of PKN2 was confirmed by Western blotting.

The full-length cDNAs of human STAT3, SNHG17, and SNHG17-mt (mutations at the putative miR-214-3p binding sites) were synthesized and cloned into the expression vector pcDNA3.1. The small hairpin RNA of SNHG17 (shSNHG17) (5′-GAUUGUCAGCUGACCUCUGUCCUGU-3′) was synthesized and cloned into the pGLVH1/GFP/Puro vector (GenePharma, Shanghai, China). STAT3, SNHG17, and CDK6 siRNAs were purchased from Ambion (Waltham, MA, USA). STAT1, KLF5, CTCF, and SP1 siRNAs were purchased from GenePharma (Shanghai, China). Both miR-214-3p mimics and inhibitors were synthesized by RiboBio (Guangzhou, China). The plasmid vectors and siRNAs were transfected into OC cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. For stably transfected cell line construction, stable clones of SNHG17- and pcDNA3.1-transfected OVCAR-3 cells were selected for 2 weeks using G418, and stable clones of shSNHG17 and shNC-transfected OVCAR-3 cells were selected for 2 weeks using puromycin. After selection, the expression level of SNHG17 was determined by qRT-PCR.