RT-qPCR was performed as previously described 11 (link). Total RNA was extracted according to the instructions for Trizol reagent (Invitrogen, Waltham, MA, United States). PrimeScript RT Master Mix [Takara Biotechnology (Dalian) Co., Ltd., Japan] were reverse transcribed into cDNA, and finally qRT-PCR assay was performed according to Premix Ex TaqTM II [Takara Biotechnology (Dalian) Co., Ltd.]. GAPDH was used as an internal reference gene to calibrate relative expression levels. The sequence of primers of genes to be detected is shown in Table S3 .
Premix ex taqtm 2
Manufactured by Takara Bio
Sourced in Japan, United States, China
Premix Ex Taq™ II is a ready-to-use PCR master mix developed by Takara Bio. It contains all the necessary reagents, including DNA polymerase, dNTPs, and reaction buffer, to perform efficient and reliable PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Rnaprep pure plant kit, by Tiangen Biotech (1 mentions)
Supersignal chemiluminescent substrate, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480 real time pcr system, by Roche (1 mentions)
Miscript 2 rt kit, by Takara Bio (1 mentions)
Prism 7500 real time pcr system, by Takara Bio (1 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
5 protocols using premix ex taqtm 2
1
Quantitative Real-Time PCR Protocol
2
Tissue-Specific Expression of GmVOZs and GsVOZs under Drought Stress
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
G. max cv. William-82 and G. soja cv. W05 were used as plant material to determine the tissue specific expression pattern under normal as well as under drought stress conditions. To analyze the expression of GmVOZs and GsVOZs genes in different tissue and development stages, soybean plants were grown at research farm of MNS University of Agriculture, Multan, and all samples were collected under field conditions with standard agronomic practices. To explore the expression under drought conditions, William-82 and W05 were grown in a 3:1 (w/w) mixture of soil and sand (day/night temperature 22/20°C), germinated and irrigated with Hoagland solution once in every two days. After 28 days, the seedlings were germinated with 20% Poly Ethylene Glycol 6000 (PEG). Root samples from control and treated seedlings were taken at 0h, 1h, 3h and 6h after treatment. RNA was extracted using RNAprep Pure Plant Kit (TIANGEN, China). PrimeScript®RT reagent kit (Takara, China) was used to synthesize cDNA. For qRT-PCR, Premix Ex TaqTM II (Takara) was used and PCR amplification was performed on CFX connect Real-Time PCR detection system (Hercules, California 94547, U.S.A). The housekeeping genes, Actin and GAPDH, were used as internal control in G. max and G. soja, respectively. Each experiment was conducted in triplicates. Oligonucleotide sequences used in current work are listed in S1 Table .
3
Quantitative Gene and Protein Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells using Trizol reagent (Invitrogen, Waltham, MA, United States). Approximately 500 ng of RNA was used for the reverse transcription reaction with PrimeScript RT Master Mix [Takara Biotechnology (Dalian) Co., Ltd., Japan]. Then, with GAPDH as the internal control, real-time quantitative polymerase chain reaction (RT-qPCR) was performed using Premix Ex TaqTM II [Takara Biotechnology (Dalian) Co., Ltd.] with the Roche Light Cycler 480 Real-Time PCR system. The sequence of primers is as follows: AIFM2 forward: TTACAAGCCAGAGACTGACCAA, reverse: ACAAGGCCTGTCACTGAAGAG; NFS1 forward: CA CTCCCGGACACATGCTTAT, reverse: TGTCTGGGTGGTGAT CAAGTG; GAPDH forward: ATCATCAGCAATGCCTCCTG, reverse: ATGGACTGTGGTCATGAGTC.
Protein samples (50 μg) were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis in 4–12% gel and transferred to nitrocellulose membranes for reaction with antibodies against target genes. Secondary antibodies, i.e., horseradish peroxidase-conjugated rabbit anti-goat and rabbit anti-mouse IgG, were detected by using SuperSignal Chemiluminescent substrate (Pierce Biotechnology, Rockford, IL, United States).
Protein samples (50 μg) were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis in 4–12% gel and transferred to nitrocellulose membranes for reaction with antibodies against target genes. Secondary antibodies, i.e., horseradish peroxidase-conjugated rabbit anti-goat and rabbit anti-mouse IgG, were detected by using SuperSignal Chemiluminescent substrate (Pierce Biotechnology, Rockford, IL, United States).
4
Quantification of Gene Expression by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRIzol Reagent (Invitrogen) was used for extract total RNA from tissues and cells. RNA was reversely transcribed into cDNA using a miScript II RT kit (TaKaRa, Biotechnology Ltd., Dalian, China) and then the real-time qPCR was performed using a Premix Ex TaqTM II (TaKaRa) on an ABI PRISM 7500 real-time PCR System. Relative gene expression was determined by the 2-ΔΔCt method. The primers are listed in Table 1 , in which U6 and GAPDH were set as the internal references for miRNA and mRNAs, respectively.
Primer sequences for RT-qPCR
| Gene | Primer sequence (5′-3′) |
|---|---|
| miR-545 | F: CGACAAGGGTCAGCAAACATT |
| R: GCAGGGTCCGAGGTATTC | |
| Bax | F: TCAGGATGCGTCCACCAAGAAG |
| R: TGTGTCCACGGCGGCAATCATC | |
| Bcl-2 | F: ATCGCCCTGTGGAGAACTACTGAGT |
| R: GCCAGGAGAAATCAAACAGAGGC | |
| KDM4B | F: GCCGAGAGGAAGTTCAACGCAG |
| R: TGCCTCCTTCTCAGAGTGTGTAGG | |
| PLK1 | F: GCACAGTGTCAATGCCTCCAAG |
| R: GCCGTACTTGTCCGAATAGTCC | |
| U6 | F: CTCGCTTCGGCAGCACA |
| R: AACGCTTCACGCATTTGC | |
| GAPDH | F: GTCTCCTCTGACTTCAACAGCG |
| R: ACCACCCTGTTGCTGTAGCCAA |
Note: RT-qPCR reverse transcription quantitative polymerase chain reaction, Bcl-2 B-cell lymphoma-2, Bax Bcl-2-associated X, KDM4B Lysine (K)-specific demethylase 4B, PLK1 Polo-like kinase 1, GAPDH glyceraldehyde-3-phosphate dehydrogenase, F forward, R reverse
5
Quantitative RT-PCR for Transcript and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For cDNA synthesis,1 μg of total RNA was used. First-strand cDNA was synthesized using a PrimeScript RT reagent kit with gDNA eraser (Takara, Dalian, China). Premix Ex TaqTM II(TaKaRa)was used for real-time quantitative PCR (qRT-PCR). Gene-specific primers are shown in Table S1 . qRT-PCR was undertaken with a 7500 Fast Real-Time PCR system (Applied Biosystems Inc., Carlsbad, CA, USA). The 25-μL reaction solutions contained 12.5 μL 2XSYBR Premix Ex TaqTM II, 1 μL forward primer, 1 μL reverse primer, 2 μL DNA template and 8.5 μL H2O. For the mature miRNAs, RT-PCR employed a stem-loop primer to detect miRNAs. The primers were based on those described by Chen et al. and Varkonyi–Gasic et al. [37 (link),38 (link)]. Their 3′-ends, which were complementary to the six nucleotides at the miRNA 3′-end, were combined with the 44-nt sequence to form a stem-loop structure.The stem-loop reverse transcription reactions were performed using M-MLV Reverse Transcriptase (Invitrogen) according to the supplier’s manual. U6 was used as a reference for small RNA expression validation [39 (link)]. The expression levels of target transcripts were normalized using the housekeeping gene UBQ7 as the reference control. Three biological replicates were used for qRT-PCR validation. The 2−ΔΔT method was used to calculate relative expression levels of salt-responsive miRNAs and target genes.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!