The largest database of trusted experimental protocols

Rt reaction kit

Manufactured by Takara Bio
Sourced in China, Japan

The RT reaction kit is a laboratory product designed for reverse transcription, a fundamental step in the analysis of RNA samples. The kit contains the necessary reagents and components to efficiently convert RNA into complementary DNA (cDNA), which can then be used for various downstream applications such as gene expression analysis, quantitative PCR, or next-generation sequencing.

Automatically generated - may contain errors

12 protocols using rt reaction kit

1

Cytokine Expression Analysis by ELISA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Trizol kit was purchased from Gibco, USA; reverse transcription (RT) reaction kit was obtained from Takara Biotechnology Co. Ltd, (Dalian, China); PCR Amplification Reagent Kit and the DNA ladder Marker was acquired from Sangon Biological Engineering Co. Ltd. (Shanghai, China); β-actin was from Santa Cruz Biotechnology, Inc. (USA); TNF-α, IL-6, IL-10 and IL-12 enzyme linked immune sorbent assay (ELISA) kits were from Science and Technology Development Center of the People’s Liberation Army General Hospital, Beijing, China.
+ Open protocol
+ Expand
2

Cytokine Expression Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The reverse transcription (RT) reaction kit was obtained from Takara Biotechnology Co. Ltd., (Dalian, China). The polymerase chain reaction (PCR) amplification reagent kit and DNA ladder marker were obtained from Sangon Biological Engineering Co. Ltd (Shanghai, China). β-actin was obtained from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). TNF-α, IL-6, IL-10 and IL-12 ELISA kits were obtained from Pierce Biotechnology Inc. (Rockford, IL, USA). Melilotus extracts were obtained from Seiko Eiyo Yakuhin Co. Ltd (Osaka, Japan).
+ Open protocol
+ Expand
3

Quantification of Viral Genome Replication

Check if the same lab product or an alternative is used in the 5 most similar protocols
Viral genome replication was measured by qRT-PCR as previously described with modifications [21 (link), 23 (link)]. Briefly, viral RNA was extracted from each sample using TRIzol reagent (Invitrogen, CA, USA). RNA pellets were suspended in 20 μl DEPC-treated water and a RT reaction was performed utilizing a RT reaction kit (Takara, Dalian, China). Target primers for the NS5B gene [24 (link)] and reference primers for the GAPDH gene [25 (link)] were used to quantify CSFV RNA. qPCR was carried out with SYBR Green PCR master mix according to the manufacturer’s protocol (Takara, Dalian, China). The data were analyzed by the 2-△△Ct method, and expression of the target gene was normalized to GAPDH mRNA levels in the same samples [26 (link)].
+ Open protocol
+ Expand
4

Comprehensive Molecular Analysis Methods

Check if the same lab product or an alternative is used in the 5 most similar protocols
A reverse transcription reaction kit was purchased from Takara Biotechnology Co. Ltd. (Dalian, China); TRIzol was from Invitrogen Life Technologies (Carlsbad, CA, USA) and electrophoresis reagents were from Promag Co. (Ningbo, China); an RT Reaction kit was obtained from Takara Biotechnology Co. Ltd (Dailan, China); a PCR Amplification Reagent kit and the 100 bp DNA ladder marker were obtained from Sangon Biological Engineering Co. Ltd. (Shanghai, China); GAPDH was obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA); rabbit anti-mouse NF-κB and VEGF polyclonal antibodies were purchased from Wuhan Boster Biological Technology, Ltd. (Wuhan, China); M. suaveolens Extract Tablets were from Seiko Eiyo Yakuhin Co. Ltd. (Osaka, Japan); fluorescein isothiocyanate (FITC)-albumin and hexadecyl-trimethyl-ammonium bromide were purchased from Sigma-Aldrich (St. Louis, MO, USA) and SYBR green I was obtained from Biotium (Hayward, CA, USA). The Oligo (dT18) and primers were synthesized by Shanghai Invitrogen (Shanghai, China). The dNTP was obtained from Promega Corp. (Madison, WI, USA).
+ Open protocol
+ Expand
5

Reprogramming Mouse Cells with OSKM

Check if the same lab product or an alternative is used in the 5 most similar protocols
High Glucose Dulbecco's Modified Eagle Medium (H-DMEM) and sucrose-based solution were from Gibco BRL (Rockville, MD, USA). Fetal bovine serum (FBS) was from HyClone Inc. (Logan, UT, USA). Trizol Reagent, PCR primers, and RT-reaction Kit were purchased from TaKaRa Biotechnology (Dalian, Liaoning, China). SYBR Green PCR Master Mix was from Applied Biosystems (Warrington, UK). LipofectamineTM2000 and Zeosin were from Invitrogen (Carlsbad, CA, USA). Basic fibroblastic growth factor (bFGF) was from Gibco (California, USA). C57BL/6 mice were from Jilin University (Jilin, China). Doxycycline (DOX) was from Sigma (San Francisco, USA). Plasmids TetO-FUW-OSKM and FUW-M2rtTA were gifts from Rudolf Jaenisch (Addgene plasmid # 20321 and # 20342).
+ Open protocol
+ Expand
6

Quantitative Real-Time PCR Transcriptome Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was purified from cells in 60-mm dishes using TRIzol (Invitrogen) according to the manufacturer’s instructions. Then, cDNA was obtained from total RNA extracted from cells using a reverse transcription (RT) reaction kit (TaKaRa, Japan). The cDNA level was determined by SYBR Premix Ex Taq™Ⅱ (TaKara, Japan), and the procedure was carried out as follows: 95°C for 30 s for one cycle, 95°C for 5 s, and 60°C for 30 s, followed by plate reading for 40 cycles. The PCR primers (Supplementary Table S1) were designed using Primer3 plus. The relative expression levels of the mRNAs in the groups were analyzed using the 2ΔΔCT method.
+ Open protocol
+ Expand
7

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was purified from cells in 60-mm dishes using TRIzol (Invitrogen) according to the manufacturer’s instructions [35 (link)]. Then, cDNA was obtained from total RNA extracted from cells using a reverse transcription (RT) reaction kit (TAKARA, Japan) [13 (link), 36 (link)]. cDNA was completed with SYBR Premix Ex Taq™II (TaKaRa, Japan), and the program was carried out as follows: 95 °C for 30 s for one cycle; then, 95 °C for 5 s and 60 °C for 30 s, followed by plate reading for 40 cycles. The PCR primers (Table S1) were designed using Primer3 plus in Supplementary Table 1. The relative expression levels of the mRNAs in the groups were analyzed using the 2ΔΔCT method [32 (link), 37 (link)].
+ Open protocol
+ Expand
8

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted with TRIzol (Invitrogen). cDNA was synthesized by reverse transcription using an RT reaction kit (Takara, Dalian, China), according to the manufacturer's instructions. Real‐time PCR was carried out according to the protocol used in our previous study.5 The primers for NDRG1 were: 5′‐TGGACCCAACAAAGACCACT‐3′ (sense) and 5′‐CCATCCAGAGAAGTGACGCT‐3′ (antisense); and for β‐actin were: 5′‐TCGTGCGTGACATTAAGGAG‐3′ (sense) and 5′‐ATGCCAGGGTACATGGTGGT‐3′ (antisense). Gene expression levels were calculated relative to the housekeeping gene β‐actin by using Stratagene Mx 3000P software (Agilent Technologies Inc., CA, USA).
+ Open protocol
+ Expand
9

Reverse Transcription and PCR Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
A reverse transcription reaction kit was purchased from Takara Biotechnology Co., Ltd. (Dalian, China). TRIzol and electrophoresis reagents were from ProMag Co., Ltd. (Ningbo, China). The RT reaction kit was obtained from Takara Biotechnology Co., Ltd. The PCR amplification reagent kit and DNA ladder/marker were obtained from Shanghai Sangon Biological Engineering Co., Ltd. (Shanghai, China). GAPDH was obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Rabbit anti-mouse Tollip, TLR4, TRAF6, p-IRAK1, VEGF-α, HO-1 and NF-κB polyclonal antibodies were purchased from Wuhan Boster Biological Technology, Ltd. (Wuhan, China). Rabbit anti-mouse IRAK1 and phosphorylated IRAK1 were purchased from Cell Signaling, Technology (Beverly, MA, USA). FITC-albumin, hexadecyl-trimethyl-ammonium bromide were purchased from Sigma-Aldrich (St. Louis, MO, USA). SYBR-Green I was obtained from Biotium (Hayward, CA, USA). The Oligo(dT)18 and primers were synthesized by Shanghai Invitrogen Biotechnology Co., Ltd (Shanghai, China). The dNTP was obtained from Promega (Madison, WI, USA).
+ Open protocol
+ Expand
10

ATO Modulation of Antioxidant Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
ATO was purchased from Pharmaceuticals Limited Company of Harbin Medical University (Harbin, China). High-glucose Dulbecco's Modified Eagle Medium (H-DMEM) was purchased from Gibco BRL (Rockville, USA). Fetal bovine serum (FBS) was purchased from HyClone Inc. (Logan, USA). PCR primers were purchased from Sangon Biotech (Shanghai, China). RNase-free DNase I, Trizol reagent and the RT-reaction kit were purchased from TaKaRa Biotechnology (Dalian, China). Actinomycin D and TSA were from Beyotime Institute of Biotechnology (Jiangsu, China). Rabbit anti-human NFE2L2 polyclonal antibody from Signalway Antibody (Maryland, USA), Mouse anti-human Histone H3 monoclonal antibody from Tianjin Sungene Biotech Co., Ltd. (Tianjin, China), Rabbit anti-human HO-1 polyclonal antibody, mouse anti-human β-actin monoclonal antibody, horseradish peroxidase (HRP)-labeled anti-rabbit IgG and anti-mouse IgG were purchased from Proteintech Group (Chicago, USA). The enhanced chemiluminescence (ECL) kit was purchased from Pierce Biotechnology, Inc. (Rockford, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!