Crispr rna

The cdk-14(K89R) point mutation was generated using the CRISPR–Cas9 system (Sakai et al., 2021a (link)). The CRISPR guide RNA (5′-GAUCUCUUUCAAGGCGACUAGUUUUAGAGCUAUGCU-3′) and single-stranded donor template DNA (5′-ACTAAATTATATTTTCAGACTTGACGGATCTATAGTCGCCTTGCGAGAGATCAAACTTCAATTTCAAGAA −3′) were synthesized [Integrated DNA Technologies (IDT)], and coinjected with the transactivating CRISPR RNA (IDT), Streptococcus pyogenes Cas9 3NLS (IDT) protein, and the Pmyo-2::dsred-monomer plasmid into the KU501 strain. Each of the F1 animals carrying the transgene was transferred onto a new dish and used for single-worm PCR, followed by DNA sequencing to detect the mutations.

The svh-11(km86) deletion mutant was generated using the CRISPR-Cas9 system as described previously (Dokshin et al. 2018 (link)). The CRISPR RNA (5′-GCTTATCCAAGCATTTGAAC-3′) corresponding to a genomic sequence within the svh-11 gene was synthesized (Integrated DNA Technologies: IDT) and co-injected with the trans-activating CRISPR RNA (IDT), Streptococcus pyogenes Cas9 3NLS (IDT) protein, and pRF4(rol-6d) plasmid into the KU501 strain. Each of the F1 animals carrying the transgene was transferred onto a new dish and used for single-worm PCR after egg laying to detect the presence of short insertions or deletions in the svh-11 gene. The descendants of these animals were selected to obtain the svh-11 homozygous mutant. The svh-11(km86) mutation is an 8-bp deletion in the svh-11 gene, causing a frame shift and premature stop codon in exon 2.

The brc-1 mutations (km88 deletion and S266A point mutation) and the dgk-3 mutations (km89 insertion and km90 deletion) were obtained using the CRISPR–Cas9 system as described previously (Dokshin et al., 2018 (link)). The CRISPR RNAs [5′-UGGAAACAUGUGGACAGAAU-3′ for brc-1(km88), 5′-UUGCGAGUUCUCAAGAUCUU-3′ for brc-1(S266A), and 5′-UAUCACCGGAGCAAUUCUCG-3′ for dgk-3(km89, km90)] and the single-stranded donor template DNA [5′-ATCAGAGAAACCAGCGAATCGAAGAGTAgccTTTGCGAGTTCTCAAGATCTTGAAAACA\TAAAAATTATG-3′ for brc-1(S266A)] were synthesized (Integrated DNA Technologies; IDT), co-injected with the trans-activating CRISPR RNA (IDT), Streptococcus pyogenes Cas9 3NLS (IDT) protein, and the pRF4(rol-6d) plasmid into the KU501 [for brc-1(km88) and brc-1(S266A)] and KU1448 [for dgk-3(km89, km90)] strains. Each of the F1 animals carrying the transgene was transferred onto a new dish and used for single-worm PCR, followed by DNA sequencing to detect the mutations. The brc-1(km88) mutation is a 2-bp deletion in the brc-1 gene, causing a frameshift and premature stop codon in exon 2. The dgk-3(km89) mutation is a 20-bp insertion that contains an in-frame stop codon, thus terminating translation in the middle of exon 1. The dgk-3(km90) mutation is a 5-bp deletion, causing a frameshift and premature stop codon in exon 1.