Log In Sign up
The largest database of trusted experimental protocols

Superscript 3 first strand synthesis system for rt pcr kit with oligo dt primers

Manufactured by Thermo Fisher Scientific
Visit Supplier

The Superscript III First Strand Synthesis System for RT-PCR kit with oligo (dT) primers is a laboratory tool used for the reverse transcription of RNA into complementary DNA (cDNA). The kit contains the SuperScript III reverse transcriptase enzyme, which is designed for high-sensitivity and reliable cDNA synthesis from a variety of RNA templates.

Automatically generated - may contain errors

Lab products found in correlation

Trizol, by Thermo Fisher Scientific (4 mentions) Pef6 v5 his topo ta expression kit, by Thermo Fisher Scientific (3 mentions)

Spelling variants of this product

SuperScript III First-Strand Synthesis System for RT-PCR (589 citations) SuperScript First-Strand Synthesis System for RT-PCR (305 citations) SuperScript III First-Strand Synthesis System for RT-PCR kit (71 citations) Superscript III First Strand Synthesis kit for RT-PCR (17 citations) SuperScript III First-Strand System for RT-PCR (7 citations) SuperScript III First-Strand Synthesis for RT-PCR (6 citations) SuperScript III First-Strand Synthesis System RT-PCR kit (5 citations) SuperScript III RT-PCR kit with oligo(dT) primer (4 citations) Superscript III RT First-Strand Synthesis system (4 citations) SuperScript III First-Strand Synthesis System for RT (3 citations)

4 protocols using superscript 3 first strand synthesis system for rt pcr kit with oligo dt primers

1

Cloning Murine SFRP1 from C2C12 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To clone murine genes, total RNA from C2C12 cells was extracted with Trizol (Invitrogen) and used to generate cDNA through the use of the Superscript III First Strand Synthesis System for RT-PCR kit with oligo dT primers (Invitrogen). Murine SFRP1 was amplified from cDNA generated from undifferentiated C2C12 cells using primers corresponding to the coding regions with engineered restriction sites. Primers are described in Additional file 7: Table S1. The resulting PCR product was cloned using restriction enzymes NotI and XhoI and the pCMV-tag1 cloning vector (Agilent). All resulting clones were confirmed by sequencing.
Adhikari A, & Davie J. (2018). JARID2 and the PRC2 complex regulate skeletal muscle differentiation through regulation of canonical Wnt signaling. Epigenetics & Chromatin, 11, 46.
+ Open protocol
+ Expand
2

Cloning of Mouse TBX2 Transcription Factor

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA from C2C12 cells was extracted with Trizol (Invitrogen) and used to generate cDNA through the use of the Superscript III First Strand Synthesis System for RT-PCR kit with oligo (dT) primers (Invitrogen). The resulting PCR product, using primers listed in Supplemental Table 1, was cloned using the pEF6/V5-His Topo TA Expression Kit (Invitrogen). The resulting mTBX2-V5 clone was confirmed by sequencing.
Zhu B., Zhang M., Byrum S.D., Tackett A.J, & Davie J.K. (2014). TBX2 blocks myogenesis and promotes proliferation in rhabdomyosarcoma cells. International journal of cancer. Journal international du cancer, 135(4), 785-797.
+ Open protocol
+ Expand
3

Cloning Murine TBX3 from C2C12 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To clone murine genes, RNA from C2C12 cells was extracted with Trizol (Invitrogen) and used to generate cDNA through the use of the Superscript III First Strand Synthesis System for RT-PCR kit with oligo (dT) primers (Invitrogen). Murine TBX3 was amplified from cDNA generated from undifferentiated C2C12 cells using primers TBX3 ORF F 5′ ATGAGCCTCTCCATGAGAGATC 3′ and R 5′ AGGGGACCCGCTGCA 3′. The resulting PCR product was TOPO cloned using the pEF6/V5-His-TOPO TA Expression Kit (Invitrogen). All resulting clones were confirmed by sequencing.
Zhu B., Zhang M., Williams E.M., Keller C., Mansoor A, & Davie J.K. (2015). TBX2 represses PTEN in rhabdomyosarcoma and skeletal muscle. Oncogene, 35(32), 4212-4224.
+ Open protocol
+ Expand
4

Cloning Murine TBX3 from C2C12 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To clone murine genes, RNA from C2C12 cells was extracted with Trizol (Invitrogen) and used to generate cDNA through the use of the Superscript III First Strand Synthesis System for RT-PCR kit with oligo (dT) primers (Invitrogen). Murine TBX3 was amplified from cDNA generated from undifferentiated C2C12 cells using primers TBX3 ORF F 5′ ATGAGCCTCTCCATGAGAGATC 3′ and R 5′ AGGGGACCCGCTGCA 3′. The resulting PCR product was TOPO cloned using the pEF6/V5-His-TOPO TA Expression Kit (Invitrogen). All resulting clones were confirmed by sequencing.
Zhu B., Zhang M., Williams E.M., Keller C., Mansoor A, & Davie J.K. (2015). TBX2 represses PTEN in rhabdomyosarcoma and skeletal muscle. Oncogene, 35(32), 4212-4224.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!