Dreamtaq green master mix 2x

The 3′-end region of the coa gene was amplified by PCR using the following primer set [10 (link)]: forward: 5′CGAGACCAAGATTCAACAAG; the reverse: 5′AAAGAAAACCACTCACATCA 3′ (Biosearch Technologies). PCR was performed in a 50 μL reaction mixture, containing 3 μL of template DNA (approximately 300 ng/μL) and 25 μL of PCR master mix (DreamTaq TM Green Master Mix (2X), Fermentas). It is a ready-to-use solution containing DreamTaq TM DNA polymerase, optimized DreamTaq TM Green buffer (2X), 4 mM MgCl and dNTPs (dATP, dCTP, dGTP, and 2dTTP, 0.4 mM each), and 2 μL (20 pmol) of each primer and 18 μL of nuclease-free water. The reaction was carried out in a thermocycler (TECHINE TC 512) as follows: initial denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 45 seconds, and extension at 72°C for 2 min, followed by a final extension at 72°C for 7 min.

Plasmid DNA was extracted from bacterial isolates using Thermo Scientific GeneJET Plasmid Miniprep Kit (Thermo, Germany, Catalogue no. K0503) for detection of antimicrobial resistant genes.
PCR amplification of virulence-related genes of P. multocida as well as antimicrobial resistance genes such as erm(X) (macrolide, lincosamides and streptogramins resistance), sul1(sulfonamide resistance), tet(H) (tetracycline resistance), bla ROB-1 (beta-lactam resistance), mcr1(colistin resistance), and dfrA1 (trimethoprim resistance) were performed by PCR assays using the oligonucleotide primer sequences presented in Table 1.
A PTC-100 programmable thermal cycler (Peltier-Effect cycling, MJ, UK) was used to conduct the PCR assays. The reaction mixture’s final volume was adjusted to 25 μL and comprised 12.5 μL of DreamTaq TM Green Master Mix (2X) (Fermentas, USA), 0.4 μL of each primer at 100 pmoL (Sigma, USA), 5 μL of template DNA, and 25 μL of nuclease-free water. The cycling conditions were: 30 cycles; 95 °C for 45 s, primer annealing (TA, Table 1) for 45 s, and 72 °C for 45 s.
On a 1.5% agarose gel (Applichem, Germany, GmbH), the PCR products were separated by electrophoresis, and the gel was photographed using a gel documentation framework (Alpha Innotech, Biometra). The data was analyzed by computer software. As a quality control, P. multocida ATCC® 43137™ was utilized.

Plasmid DNA was extracted from bacterial isolates using Thermo Scientific GeneJET Plasmid Miniprep Kit (Thermo, Germany, Catalogue no. K0503) for detection of antimicrobial resistant genes.
PCR amplification of virulence-related genes of P. multocida as well as antimicrobial resistance genes such as erm(X) (macrolide, lincosamides and streptogramins resistance), sul1(sulfonamide resistance), tet(H) (tetracycline resistance), bla ROB-1 (beta-lactam resistance), mcr1(colistin resistance), and dfrA1 (trimethoprim resistance) were performed by PCR assays using the oligonucleotide primer sequences presented in Table 1.
A PTC-100 programmable thermal cycler (Peltier-Effect cycling, MJ, UK) was used to conduct the PCR assays. The reaction mixture’s final volume was adjusted to 25 μL and comprised 12.5 μL of DreamTaq TM Green Master Mix (2X) (Fermentas, USA), 0.4 μL of each primer at 100 pmoL (Sigma, USA), 5 μL of template DNA, and 25 μL of nuclease-free water. The cycling conditions were: 30 cycles; 95 °C for 45 s, primer annealing (TA, Table 1) for 45 s, and 72 °C for 45 s.
On a 1.5% agarose gel (Applichem, Germany, GmbH), the PCR products were separated by electrophoresis, and the gel was photographed using a gel documentation framework (Alpha Innotech, Biometra). The data was analyzed by computer software. As a quality control, P. multocida ATCC® 43137™ was utilized.