The largest database of trusted experimental protocols

5 protocols using cfx manager software ver 3

1

Quantitative Analysis of Ovarian Dpp Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from newly eclosed female ovaries of tj-GAL4 > mcherry RNAi, tj- GAL4 > tj RNAi-1 and tj- GAL4 > tj RNAi-2. And rp49 was served as normalization control. To exclude the interference of the vitellarium region of ovariole, we chose the female eclosed within 2 h for dissection. RNA was isolated using TRIzol (Invitrogen) and then subjected to reverse transcription. ReverTra Ace® qPCR RT Master Mix with gDNA Remover (TOYOBO) was used for cDNA synthesis according to the manufactures’ instructions. Quantitative real-time PCR was performed on Bio-Rad CFX96 PCR system by using SYBR green qPCR Master Mix (TOYOBO).
The primers used for amplifying dpp and rp49 mRNA are as follows:
dpp forward: AGCCGATGAAGAAGCTCTACG
dpp reverse: ATGTCGTAGACAAGCACCTGGTA
rp49 forward: TCCTACCAGCTTCAAGATGAC
rp49 reverse: CACGTTGTGCACCAGGAACT
Relative concentration was determined using the 2−ΔΔCt method in Bio-Rad CFX Manager Software Ver 3.0.
+ Open protocol
+ Expand
2

RNA Extraction, cDNA Synthesis, and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA was extracted using the RNA pure Total RNA Kit (Aidlab Biotech, Beijing, China) according to the manufacturer’s instructions. The RNA samples were reversely transcribed into cDNAs using TransScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). The procedure was as follows: RNA (2 µg) mixed with 1 μL Oligod (T) 18 (0.5 μg/ μL), 2 × TS Reaction Mix (10 µL) and, TransScript RT/RI Enzyme Mix (1 µL) with an additional 20 µL of RNase-free Water to. The mixture was mixed gently and incubated at 42 °C for 15 min. The reaction was terminated by incubation at 85 °C for 5 s, and the cDNAs of the product were stored at −20 °C. The cDNA samples were used as a template, then mixed with 200 nmol primer and SYBR Green PCR Real Master Mix (Takara, Kusatsu, Japan) for real-time PCR analysis using Bio-Rad CFX 96 real-time PCR instruments and CFX manager software ver 3.0 (Bio-Rad laboratories, California, USA). The temperature procedure was as follows: 94 °C for 3 min, 32 cycles of 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 20 s. The fluorescence signal was collected during the elongation of every cycle at 72 °C. The 18S was used as an internal standard for normalization. The primers used in qRT-PCR are listed in Table S5.
+ Open protocol
+ Expand
3

Quantifying Gene Expression via RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transcript levels of genes associated with DEPs were determined using real-time quantitative polymerase chain reaction (RT-qPCR). For total RNA extraction, extract stems using an RNA Rapid Extraction Kit (Aidlab Biotech, Beijing, China) according to the operation manual. Use the Reverse Aid First Strand cDNA Synthesis Kit (TaKaRa Biotech, Beijing, China) to reverse-transcribe RNA to cDNA. The process was as follows: Mix RNA (2 μg) with 1 μL Oligo d (T) 18 (0.5 μg/μL), 2 × TS Reaction Mix (10 μL) and TransScript RT/RI Enzyme Mix (1 μL) with an extra 20 μL of RNase-free Water. Mix the mixture gently and incubate at 42 °C for 15 mins. Terminate the reaction by incubation at 85 °C for 5 s, and store the cDNAs of the product at − 20 °C. Use the cDNA samples as a template, and then mix them with 200 nmol primer and SYBR Green PCR Real Master Mix (TakaRa, Kusatsu, Japan) for real-time PCR analysis using Bio-Rad CFX 96 real-time PCR instruments and CFX manager software ver 3.0 (Bio-Rad Laboratories, California, USA). The PCR temperature procedure is as follows: 95 °C of predegeneration for 3 mins, 40 cycles of denaturation at 95 °C for 20 s, annealing at 59 °C for 20 s, and extension at 72 °C for 20 s. Use the 18S sequence as an internal standard for standardization.
+ Open protocol
+ Expand
4

Myoblast RNA Isolation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human or mouse myoblast cells were seeded in a 150 mm Petri dish (3000 cells/cm2). After 2 days, total RNA was isolated with RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. cDNA was obtained using Superscript III cDNA Synthesis Kit (Invitrogen) and was subjected to real-time PCR (1 µg per reaction) using SYBR Green Kit (Bio-Rad, Hercules, CA). Primers for real-time PCR were listed in Supplementary Table 4. Bio-Rad Software CFX Manager Ver 3.1 was used for qPCR cycle determination.
+ Open protocol
+ Expand
5

Transcriptome Analysis of TA Muscle

Check if the same lab product or an alternative is used in the 5 most similar protocols
TA muscles were weighed, and 9–10 mg of the muscle was cut for RNA isolation. RNA was isolated using RNeasy Fibrous Tissue Mini Kit (Catalog # 74704, Qiagen, Valencia, CA) as per manufacturer’s instructions. cDNA was synthesized using the Superscript III cDNA Synthesis Kit (Thermo Fisher Scientific). For real-time PCR analysis, 1 μg of cDNA was used per reaction, and the SYBR Green Kit (Bio-Rad) was employed. The specific primers for the real-time PCR were listed in Table 3. The qPCR cycle determination was performed using Bio-Rad Software CFX Manager Ver 3.1.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!