Cfx manager software ver 3

RNA was isolated from newly eclosed female ovaries of tj-GAL4 > mcherry RNAi, tj- GAL4 > tj RNAi-1 and tj- GAL4 > tj RNAi-2. And rp49 was served as normalization control. To exclude the interference of the vitellarium region of ovariole, we chose the female eclosed within 2 h for dissection. RNA was isolated using TRIzol (Invitrogen) and then subjected to reverse transcription. ReverTra Ace® qPCR RT Master Mix with gDNA Remover (TOYOBO) was used for cDNA synthesis according to the manufactures’ instructions. Quantitative real-time PCR was performed on Bio-Rad CFX96 PCR system by using SYBR green qPCR Master Mix (TOYOBO).
The primers used for amplifying dpp and rp49 mRNA are as follows:
dpp forward: AGCCGATGAAGAAGCTCTACG
dpp reverse: ATGTCGTAGACAAGCACCTGGTA
rp49 forward: TCCTACCAGCTTCAAGATGAC
rp49 reverse: CACGTTGTGCACCAGGAACT
Relative concentration was determined using the 2^−ΔΔCt method in Bio-Rad CFX Manager Software Ver 3.0.

The total RNA was extracted using the RNA pure Total RNA Kit (Aidlab Biotech, Beijing, China) according to the manufacturer’s instructions. The RNA samples were reversely transcribed into cDNAs using TransScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). The procedure was as follows: RNA (2 µg) mixed with 1 μL Oligod (T) 18 (0.5 μg/ μL), 2 × TS Reaction Mix (10 µL) and, TransScript RT/RI Enzyme Mix (1 µL) with an additional 20 µL of RNase-free Water to. The mixture was mixed gently and incubated at 42 °C for 15 min. The reaction was terminated by incubation at 85 °C for 5 s, and the cDNAs of the product were stored at −20 °C. The cDNA samples were used as a template, then mixed with 200 nmol primer and SYBR Green PCR Real Master Mix (Takara, Kusatsu, Japan) for real-time PCR analysis using Bio-Rad CFX 96 real-time PCR instruments and CFX manager software ver 3.0 (Bio-Rad laboratories, California, USA). The temperature procedure was as follows: 94 °C for 3 min, 32 cycles of 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 20 s. The fluorescence signal was collected during the elongation of every cycle at 72 °C. The 18S was used as an internal standard for normalization. The primers used in qRT-PCR are listed in Table S5.

Transcript levels of genes associated with DEPs were determined using real-time quantitative polymerase chain reaction (RT-qPCR). For total RNA extraction, extract stems using an RNA Rapid Extraction Kit (Aidlab Biotech, Beijing, China) according to the operation manual. Use the Reverse Aid First Strand cDNA Synthesis Kit (TaKaRa Biotech, Beijing, China) to reverse-transcribe RNA to cDNA. The process was as follows: Mix RNA (2 μg) with 1 μL Oligo d (T) 18 (0.5 μg/μL), 2 × TS Reaction Mix (10 μL) and TransScript RT/RI Enzyme Mix (1 μL) with an extra 20 μL of RNase-free Water. Mix the mixture gently and incubate at 42 °C for 15 mins. Terminate the reaction by incubation at 85 °C for 5 s, and store the cDNAs of the product at − 20 °C. Use the cDNA samples as a template, and then mix them with 200 nmol primer and SYBR Green PCR Real Master Mix (TakaRa, Kusatsu, Japan) for real-time PCR analysis using Bio-Rad CFX 96 real-time PCR instruments and CFX manager software ver 3.0 (Bio-Rad Laboratories, California, USA). The PCR temperature procedure is as follows: 95 °C of predegeneration for 3 mins, 40 cycles of denaturation at 95 °C for 20 s, annealing at 59 °C for 20 s, and extension at 72 °C for 20 s. Use the 18S sequence as an internal standard for standardization.