Superscript one step rt pcr system with platinum taq dna polymerase

Total RNA was isolated with PureLink RNA Mini Kit according to the manufacturer instructions (ThermoFisherScientific). Purified RNAs were treated with RNase-free DNaseI (TURBO DNase, ThermoFisherScientific), extracted with acidic phenol/chloroform and concentrated by ethanol precipitation. DNA-free RNA was suspended in RNase-free water and stored at -80°C. Synthesis of cDNA was performed with the RevertAid First Strand cDNA Synthesis kit in the presence of random hexamer primers (ThermoFisherScientific). End-point RT-PCRs were performed with SuperScript^™ One-Step RT-PCR System with Platinum^™ Taq DNA Polymerase (ThermoFisherScientific). Real-time PCR reactions were performed with human ACBD6, NMT1, NMT2 and ACTB gene specific PrimeTime qPCR Primers (IDT DNA), using iTAQ SYBR Green Supermix with ROX (Bio-Rad, Hercules, CA). Quadruplicated reactions were performed in 5μl volumes in a 384-well plate and were run on an ABI7900HT instrument (Applied Biosystems, Foster City, CA). Ct values of ACBD6, NMT1 and NMT2 were normalized to the values obtained for ACTB. Normalized values (ΔCt) obtained in control normal cells were used as reference and the ΔΔCt method was used to determine the fold change in expression of ACBD6, NMT1 and NMT2 in the mutant cells compared to the normal cells.

RNA was isolated by standard RNA extraction using TRIzol® Reagent (Life Technologies, Carlsbad, CA, USA) and transformed into complementary DNA (cDNA) by using the SuperScript One-Step RT-PCR System with Platinum Taq DNA polymerase (Life Technologies) using a thermocycler (Eppendorf, Hamburg, Germany).

RNA was extracted using Ambion^® RNA extraction kit (Cat# 10928-034, Life Technologies, USA) according to the manufacturer's instructions. Then, RNA was reverse transcribed and amplified by qRT-PCR using a SuperScript^® One-Step RT-PCR System with Platinum^® Taq DNA Polymerase (Cat# 10966034, Life Technologies, USA) on a 7500 Real Time PCR System (Applied Biosystems, USA). The annealing and extension steps were separated as follows (three-step cycling): Step 1, 1 cycle at 45–55°C for 20 minutes plus 94°C for 2 minutes; step 2, 35 cycles of denaturing at 94°C for 15 seconds, annealing at 55–60°C for 30 seconds and extending at 68–72°C for 1 minute/kb. The RNA expression level for each sample was normalized to the expression of GAPDH or RNU6B and calculated using the 2^-ΔΔct method [35 (link)], with three biological replicates of comparative qRT-PCR. The following primer sequences were used for qRT-PCR: GPD1, (forward) 5′- TGCTGAATGGGCAGAAAC-3′ and (reverse) 5′- AAAT GTGGTGGCATGAGG-3′; GAPDH, (forward) 5′- AGCCACATCGCTCAGACAC -3′ and (reverse) 5′- GCCCAATACGACCAAATCC -3′; miR-370-RT, 5′- GTCGTATCCAGTGCAGGGTCCG AGGTGCACTGGATACGACACCAGG -3′, (forward) 5′- TGCGGGCCTGCTGGGGTGGAAC -3′ and (reverse) 5′-CCAGTGCAGGGTCCGAGGT -3′; RNU6B-RT, 5′- GTCGTATCCAGTG CAGGGTCCGAGGTATTCGCACTGGATACGACAA AATATGGAAC -3′, (forward) 5′- TGCGGG TGCTCGCTTCGGCAGC -3′ and (reverse) 5′- CCA GTGCAGGGTCCGAGGT -3′.

RNAs were extracted using Ambion® RNA extraction kit (Cat# 10928-034, Life Technologies, USA) according to the manufacturer’s instructions. Then, RNAs were than reverse transcribed and amplified by qRT-PCR using the SuperScript® One-Step RT-PCR System with Platinum® Taq DNA Polymerase (Life Technologies, USA) on a 7500 Real Time PCR System (Applied Biosystems, Mannheim, Germany). The annealing and extension steps were separated as follows (three-step cycling): Step 1, 1 cycle at 45–55 °C for 20 minutes plus 94 °C for 2 minutes; step 2, 35 cycles of denaturing at 94 °C for 15 seconds, annealing at 55–60 °C for 30 seconds and extending at 68–72 °C for 1 minute/kb.