Superscript 3 platinum two step qrt pcr kit with sybr green

RNA was extracted from sorted T cells using RNAeasy Plus Mini Kit (Qiagen: catalog no. 74034). One-hundred micrograms of RNA was reverse-transcribed and subjected to qPCR using the SuperScript III Platinum Two-Step qRT-PCR Kit with SYBR Green (Invitrogen: catalog no. 11744500). qPCR was performed on the StepOne Real-Time PCR System (Applied Biosystems). Each sample was run in triplicate for each gene and the cDNA from each sample was divided equally per reaction in a 20 µL volume. The qPCR conditions were as follows: 50°C for 2 minutes and 95°C for 2 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 30 seconds. Melting curve analysis was performed to confirm a single amplicon. Differences in gene expression were determined using the equation 2^–ΔΔC_t, where the C_t value of Bhlhe40 was subtracted from the C_t value of the Gapdh control to yield the ΔC_t value. For each sample, the ΔC_t value of Bhlhe40 done in triplicate was averaged and compared to give one ΔΔC_t value per sample. Mouse quantitative RT-PCR primers for Bhlhe40 were as follows: forward primer-5′ ACGGAGACCTGTCAGGGATG3′ and reverse primer-5′GGCAGTTTGTAAGTTTCCTTGC3′. Mouse quantitative RT-PCR primers for Gapdh were as follows: forward primer-5′AGGTCGGTGTGAACGGATTTG3′ and reverse primer-5′TGTAGACCATGTAGTTGAGGTCA3′ (Integrated DNA Technologies, custom order).