Maxima first strand cdna synthesis kit for rt qpcr

Manufactured by Thermo Fisher Scientific

Sourced in United States, Lithuania, Poland, Australia, Germany

The Maxima First Strand cDNA Synthesis Kit for RT-qPCR is a reagent kit designed for the synthesis of first-strand cDNA from total RNA or poly(A)+ RNA templates. It includes an M-MuLV Reverse Transcriptase enzyme, RiboLock RNase Inhibitor, and necessary reaction buffers and components.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

CDNA synthesis kit (1264 citations) Maxima RT (33 citations) RT-qPCR kit (33 citations) Maxima First Strand cDNA Synthesis (16 citations) Maxima First Strand cDNA Synthesis Kits for RT-qPCR (9 citations) RT kits (5 citations) CDNA kits (3 citations) QPCR kits (2 citations)

267 protocols using maxima first strand cdna synthesis kit for rt qpcr

Simultaneous DNA and RNA Extraction from Soil

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Both DNA and RNA were simultaneously extracted from soil samples (2 g each), using a lab-made protocol based on phenol-chloroform-isoamylalcohol extraction (Harkes et al., 2019 (link)). Quality and quantity of the obtained RNA and DNA was measured with a Nanodrop and Qubit. The nucleic acid eluate was stored at -80°C until further processing. For synthesis of cDNA from extracted RNA, the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Fermentas, Thermo Fisher Scientific Inc., USA) was used according to the manufacturer’s instructions. All individual DNA and cDNA samples were diluted to 1 ng/µl and 0.1 ng/µl, respectively, and used as template for PCR amplification.
To estimate the nematode density, a subsample of the nematode suspension (1/10 of each sample) was counted under a dissecting microscope. This was done in triplicate. Hereafter, nematode suspensions were concentrated and lysed according to Vervoort et al. (2012) (link). This resulted in 100 µl purified DNA, which served as a template for quantitative PCR (qPCR).

Harkes P., van Steenbrugge J.J., van den Elsen S.J., Suleiman A.K., de Haan J.J., Holterman M.H, & Helder J. (2020). Shifts in the Active Rhizobiome Paralleling Low Meloidogyne chitwoodi Densities in Fields Under Prolonged Organic Soil Management. Frontiers in Plant Science, 10, 1697.

+ Open protocol

+ Expand

Lung RNA Extraction and Quantitative PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from lungs were extracted with Trizol® Reagent (Invitrogen), according to the manufacturer's instructions. The mRNA was DNAse treated for 30 min at 37°C before heat denaturation of the enzyme (Fermentas). The treated RNA (300 ng) was reverse transcribed using Maxima First Strand cDNA Synthesis Kit for RT‐qPCR (Fermentas). Resulting cDNA was then diluted by 5 in sterile distilled water and subsequently used as a template. Quantitative PCR was performed using SYBR Green Taq Ready Mix (Qiagen). Samples were amplified in a LightCycler® 480 System (Roche). Results were normalized to the amount of 18S RNA. RT and Q‐PCR analyses were performed in duplicate. The 2^‐ΔΔCt method was applied to estimate relative transcript levels. The primer sequences were as follows: 18S_forward 5′‐AACTTTCGATGGTAGTCGCCGT‐3′,18S_reverse 5′‐TCCTTGGATGTGGTAGCCGTTT‐3′, KC_forward 5'‐AAGCTCCCTTGGTTCAGAAA ‐3', KC_reverse 5'‐TCAGAAGCCAGCGTTCAC‐3', CXCL2_forward 5'‐ GCCAAGGGTTGACTTCAAGA‐3', CXCL2_reverse 5'‐ CTTCAGGGTCAAGGCAAACT ‐3'.

Rocca J., Manin S., Hulin A., Aissat A., Verbecq‐Morlot W., Prulière‐Escabasse V., Wohlhuter‐Haddad A., Epaud R., Fanen P, & Tarze A. (2016). New use for an old drug: COX‐independent anti‐inflammatory effects of sulindac in models of cystic fibrosis. British Journal of Pharmacology, 173(11), 1728-1741.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cellular mRNA was extracted using the RNeasy Plus mini kit (Qiagen). mRNA was eluted in RNase‐free water. Absorption spectra were measured on an ND‐1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE) before storage at −80°C. RNA was reverse‐transcribed to cDNA using the ‘Maxima First Strand cDNA Synthesis kit for RT‐qPCR’ (Fermentas); 3 µg of RNA was used for each sample. The obtained cDNA was stored at −20°C before qPCR. Real‐time PCR was performed on a LightCycler 480 (Roche) using SYBR Premix Ex Taq (Perfect Real Time) (Takara) and QuantiTect Primer Assay (Qiagen) in white 96‐well optical microtiter plates (Roche). All reactions were performed in triplicate and reported as average values. For reference, seven housekeeping genes were tested. Means and standard deviations were calculated, and the gene which had the lowest standard deviation was chosen as the reference. For each target gene, the mean and standard deviation were calculated and then normalized by the corresponding value for the reference gene (ppia), to obtain the ΔCp.

El Hafny‐Rahbi B., Brodaczewska K., Collet G., Majewska A., Klimkiewicz K., Delalande A., Grillon C, & Kieda C. (2021). Tumour angiogenesis normalized by myo‐inositol trispyrophosphate alleviates hypoxia in the microenvironment and promotes antitumor immune response. Journal of Cellular and Molecular Medicine, 25(7), 3284-3299.

+ Open protocol

+ Expand

RNA Isolation and Gene Expression Analysis in tMCAO

Check if the same lab product or an alternative is used in the 5 most similar protocols

We isolated RNA from brain tissue at indicated timepoints following tMCAO. Hemispheres were separated and homogenized in TRIzol Reagent (1 ml per 100 mg tissue), chloroform was added, samples were centrifuged at 12,000×g for 15 min at 4 °C and the upper aqueous phase was collected. RNA was precipitated by the addition of isopropyl alcohol, washed and dissolved in TE-Buffer. We isolated total RNA from cells using QIA-Shredder spin columns and the RNeasy Micro Kit (QIAGEN) and transcribed complementary DNA using Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Fermentas). Real-time PCR primers were obtained from Applied Biosystems (Carlsbad, CA): Il6: Mm00446190_m1; Il23: Mm00518984_m1; Il1b: Mm00434228_m1; Tgfb: Mm01178820_m1; Cxcl1 Mm00433859_m1; Mmp3: Mm00442991_m1; BActin: Mm00607939_s1, Sdha: Mm01352366_m1. Probe mixtures were purchased from Fermentas (Waltham, MA). The relative gene expression was calculated using the ΔΔCt method and the samples were normalized to the control population and the expression of Sdha or β-Actin. Samples were randomized and coded by an independent researcher, so experiments were carried out blindly.

Piepke M., Clausen B.H., Ludewig P., Vienhues J.H., Bedke T., Javidi E., Rissiek B., Jank L., Brockmann L., Sandrock I., Degenhardt K., Jander A., Roth V., Schädlich I.S., Prinz I., Flavell R.A., Kobayashi Y., Renné T., Gerloff C., Huber S., Magnus T, & Gelderblom M. (2021). Interleukin-10 improves stroke outcome by controlling the detrimental Interleukin-17A response. Journal of Neuroinflammation, 18, 265.

+ Open protocol

+ Expand

Gene Expression Analysis in Mouse Brain Regions

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mice were sacrificed by decapitation, and heads were snap frozen in liquid nitrogen. Cerebral cortex, striata and hippocampus were punched on dry ice and stored at −80°C until RNA isolation. Samples were homogenized in QIAzol® reagent (Qiagen). RNA isolation was performed with RNeasy® Lipid Tissue Midi kit (Qiagen) according to manufacturer’s instructions. Reverse transcription was performed with Maxima First Strand cDNA synthesis kit for RT-qPCR (Fermentas). Quantitative real-time PCR reactions were performed using LightCycler® 480 SYBR® Green I Master according to manufacturer’s protocol and run on LightCycler® 480 (Roche Diagnostics). Expression of hypoxanthine guanine phosphoribosyltransferase 1 (
Hprt1) transcript was used to normalize the cDNA amounts. The cycle threshold values were calculated automatically by LightCycler® 480 SW 1.5 software with default parameters. For primers sequences see the
Supplementary material.

Boussicault L., Alves S., Lamazière A., Planques A., Heck N., Moumné L., Despres G., Bolte S., Hu A., Pagès C., Galvan L., Piguet F., Aubourg P., Cartier N., Caboche J, & Betuing S. (2016). CYP46A1, the rate-limiting enzyme for cholesterol degradation, is neuroprotective in Huntington’s disease. Brain, 139(3), 953-970.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRI reagent® (Sigma, Saint Quentin Fallavier, France), according to the manufacturer’s protocol. First strand cDNA was synthesized from 0.5μg total RNA using Maxima First Strand cDNA Synthesis Kit for RT-qPCR from Fermentas (Thermo Scientific). The real-time PCR contained, in a final volume of 20 μl, 2 ng reverse transcribed total RNA, SYBR green buffer (Bio-Rad, Marnes-la-Coquette, France), 300 nM of the forward and reverse primers: and (Bio-Rad). PCRs were performed in triplicate in 96-well plates, using the CFX96 Real-Time PCR detection system (Bio-Rad). Human Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an invariant control (Table S1).

Thevenon J., Duplomb L., Phadke S., Eguether T., Saunier A., Avila M., Carmignac V., Bruel A.L., St-Onge J., Duffourd Y., Pazour G.J., Franco B., Attie-Bitach T., Masurel-Paulet A., Rivière J.B., Cormier-Daire V., Philippe C., Faivre L, & Thauvin-Robinet C. (2016). Autosomal Recessive IFT57 hypomorphic mutation cause ciliary transport defect in unclassified oral-facial-digital syndrome with short stature and brachymesophalangia. Clinical genetics, 90(6), 509-517.

+ Open protocol

+ Expand

Quantitative PCR Analysis of FOXO Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was harvested using GeneJET RNA purification kit (Fermentas) and treated with RQ1 RNase‐free DNase (Promega). Then, one microgram of total RNA was reverse‐transcribed into cDNA utilizing Maxima^® first‐strand cDNA synthesis kit for RT‐qPCR (Fermentas). PCR was performed on cDNA samples using the Power SYBR^® Green Master mix (Applied Biosystems) and was performed the PCR on the StepOnePlusTM Real Time PCR System (Applied Biosystems). Primer sequences are as below. Each sample was run as duplicates (triplicates), and the mRNA level of each sample was normalized to that of the 18s mRNA. The relative mRNA level was presented as unit values of 2^{[Ct(18s) – Ct(gene of interest)]}. Primers are as follows:

h18s	F	CCGATAACGAACGAGACTCTGG
h18s	R	TAGGGTAGGCACACGCTGAGCC
hFOXO1	F	CAAGAGCGTGCCCTACTTCAA
hFOXO1	R	CAGCTCGGCTTCGGCTCTTA
hFOXO3	F	GTGCGTTGCGTGCCCTACTTC
hFOXO3	R	CATTCTGGACCCGCATGAATCG
hFOXO4	F	CAGGCCATTGAAAGCGCCC
hFOXO4	R	GCCTCGTTGTGAACCTTGATGA
hFOXO6	F	CGCAGATCTACGACTGGATGGT
hFOXO6	R	CACCACGAACTCTTGCCGGT
m18s	F	CCGATAACGAACGAGACTCTGG
m18s	R	AGGGTAGGCACACGCTGAGCC
mFOXO1	F	CTACGAGTGGATGGTGAAGAGC
mFOXO1	R	CCAGTTCCTTCATTCTGCACTCG
mFOXO3	F	CCTACTTCAAGGATAAGGGCGAC
mFOXO3	R	GCCTTCATTCTGAACGCGCATG
mHBP1	F	CCTCTCCAGGATACAACTCCTGTGA
mHBP1	R	GGTATATGGCAGATTGGGTAGGGT

Hwang I., Oh H., Santo E., Kim D., Chen J.W., Bronson R.T., Locasale J.W., Na Y., Lee J., Reed S., Toth M., Yu W.H., Muller F.L, & Paik J. (2017). FOXO protects against age‐progressive axonal degeneration. Aging Cell, 17(1), e12701.

+ Open protocol

+ Expand

Relative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Relative gene expression was determined using a two-steps quantitative real-time PCR method. Total RNA was isolated on day 30 of differentiation with the PureLink^® RNA Mini Kit (Life Technologies) and reverse-transcribed using the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Life Technologies). Quantitative RT-PCR was performed with SYBR Select Master Mix (Life Technologies) on the LightCycler^® 480 Instrument II (Roche Life Science, Bale, Swiss). Fold changes in gene expression were determined using the comparative CT method (ddC_t) with normalization to the housekeeping gene RPL32. All the primers used are listed in Table S1.

Jeziorowska D., Fontaine V., Jouve C., Villard E., Dussaud S., Akbar D., Letang V., Cervello P., Itier J.M., Pruniaux M.P, & Hulot J.S. (2017). Differential Sarcomere and Electrophysiological Maturation of Human iPSC-Derived Cardiac Myocytes in Monolayer vs. Aggregation-Based Differentiation Protocols. International Journal of Molecular Sciences, 18(6), 1173.

+ Open protocol

+ Expand

Lung Tissue RNA Extraction and Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from lung tissue was extracted from peqGOLD Trifast using the Direct-zol RNA MiniPrep Kit (Zymo Research) according to the manufacturer’s protocol. Isolated RNA was reverse transcribed according to the manufacturer’s instructions (Maxima First Strand cDNA Synthesis Kit for RT-qPCR, Life Technologies). qRT-PCR was performed using LightCycler 480 SYBR Green I Master (Roche) on the LightCycler 480 instrument. Analysis of the relative changes was performed using LightCycler480 Software 1.5.0 SP4 (version 1.5.0.39, Roche). All quantifications were normalized to the level of Gapdh gene expression. The following primers were used: Gapdh forward ATTGTCAGCAATGCATCCTG, reverse ATGGACTGTGGTCATGAGCC; Arg1 forward ACAAGACAGGGCTCCTTTCAG, reverse CTGTGATGCCCCAGATGGTT; Fizz1 forward ATGAACAGATGGGCCTCCTG, reverse TCTTAGGACAGTTGGCAGCA; Il1a forward CGCTTGAGTCGGCAAAGAAATC, reverse GTGCAAGTCTCATGAAGTGAGC; Il1rn forward TGTGCCAAGTCTGGAGATGA, reverse TTCTTTGTTCTTGCTCAGATCAGT (22 (link)); Il10 forward GGTTGCCAAGCCTTATCGGA, reverse ACCTGCTCCACTGCCTTGCT; Mx1 forward ATGGGTGAACTCAGGCAATCTC, reverse TTGACAGTCTCCTGCTTAGTGAC; Nos2 forward CTGCAGCACTTGGATCAGGA, reverse TCCTTTGAGCCCTTTGTGCT.

Ring S., Eggers L., Behrends J., Wutkowski A., Schwudke D., Kröger A., Hierweger A.M., Hölscher C., Gabriel G, & Schneider B.E. (2019). Blocking IL-10 receptor signaling ameliorates Mycobacterium tuberculosis infection during influenza-induced exacerbation. JCI Insight, 4(10), e126533.

+ Open protocol

+ Expand

Quantitative Real-Time RT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from FHs74Int cells by Geneaid Total RNA Mini Kit (Geneaid Biotech Ltd., New Taipei City, Taiwan). Equal RNA was reverse-transcribed using Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Life Technologies) to generate the first-stranded cDNA. The mRNA expressions were determined by real-time RT-PCR using the LightCycler 480 SYBR Green I Master enzyme mix on a Light Cycler 480 system (Roche Diagnostics, Mannheim, Germany). The nucleotide sequences of the primer pairs are shown in Table 1. The results were analyzed by the LightCycler 480 software version 1.5.0.39 (Roche Diagnostics). The relative mRNA expression was determined in comparison with RN18S as an internal control using the ∆∆Ct method [18 (link)]. Data were normalized and presented as the ratio of their control values.

Veres-Székely A., Bernáth M., Pap D., Rokonay R., Szebeni B., Takács I.M., Lippai R., Cseh Á., Szabó A.J, & Vannay Á. (2020). PARK7 Diminishes Oxidative Stress-Induced Mucosal Damage in Celiac Disease. Oxidative Medicine and Cellular Longevity, 2020, 4787202.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!