PCR-hsp70-234 products were purified with the EXOSAP-ITTM Express PCR Product Cleanup (AppliedBioystems®, University Park, IL, USA) and prepared for sequencing using the BigDye Terminator Kit v3.1 (Thermo Fisher Scientific®, Waltham, MA, USA) according to the manufacturer’s instructions. The forward and reverse sequences were obtained using the ABI3500XL automatic DNA analyzer. The sequences obtained were mounted in CAP3 software (Iowa State University, Ames, IA, USA), aligned using MAFFT v.7.221 (Universitu of Osaka, Osaka, Japan) [22 (link)], edited in Geneious v.8.1.7 software (Biomatters Ltd., Auckland, New Zealand) [23 (link)], and compared with sequences available in GenBank using the BLAST tool. Phylogenetic analyses were performed in three stages: (i) determination of the evolutionary model and likelihood analysis using the IQ-TREE v.1.3.2; (ii) phylogenetic reconstruction in IQ-TREE v.1.3.2 software (Center for Integrative Bioinformatics Vienna, Wien, Austria) using a non-parametric reliability test of 1000 replicates and bootstraps; and (iii) editing of the phylogenetic tree using FigTree v.1.4.2 software (University of Edinburgh, Edinburgh, UK) [24 (link)].
Big dye terminator kit v3
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom
The Big Dye Terminator Kit v3.1 is a DNA sequencing reagent system developed by Thermo Fisher Scientific. The kit provides the necessary components for Sanger DNA sequencing, including DNA polymerase, fluorescently labeled dideoxynucleotides, and other essential reagents.
Automatically generated - may contain errors
Lab products found in correlation
Qiaquick pcr purification kit, by Qiagen (5 mentions)
Power taq polymerase, by Genomics Plc (5 mentions)
3730xl dna analyzer, by Thermo Fisher Scientific (4 mentions)
Abi 3130xl genetic analyzer, by Thermo Fisher Scientific (3 mentions)
Abi prism 3730xl dna analyser, by Thermo Fisher Scientific (3 mentions)
Qiaamp dna blood mini kit, by Qiagen (3 mentions)
Abi 3130 automatic genetic analyzer, by Thermo Fisher Scientific (3 mentions)
Dneasy blood and tissue kit, by Qiagen (3 mentions)
Abi 3730xl dna analyzer, by Thermo Fisher Scientific (3 mentions)
2720 thermal cycler, by Thermo Fisher Scientific (2 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (2 mentions)
Abi 3500xl, by Thermo Fisher Scientific (2 mentions)
Abi prism 3730xl dna analyzer, by Thermo Fisher Scientific (2 mentions)
Sequencher, by Gene Codes (2 mentions)
Abi prism 3100 genetic analyzer, by Thermo Fisher Scientific (2 mentions)
Purelink pcr purification kit, by Thermo Fisher Scientific (2 mentions)
High pure pcr product purification kit, by Roche (2 mentions)
Genejet plasmid miniprep kit, by Thermo Fisher Scientific (2 mentions)
Exosap it reagent, by Thermo Fisher Scientific (2 mentions)
3130 genetic analyzer, by Thermo Fisher Scientific (2 mentions)
79 protocols using big dye terminator kit v3
1
Phylogenetic Analysis of hsp70-234 Gene
2
16S rRNA Gene Amplification and Bacterial Typing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial DNA was identified by PCR targeting the 16S rRNA gene using the following primers: 5′-CCAGACTCCTACGGGAGGCAG-3′ (V3 region) and 5′-ACATTTCACAACACGAGCTGACGA-3′ (V6 region) [48 (link), 49 (link)]. The PCR products from 16S rRNA were purified and used in sequencing the PCR reactions with the abovementioned primers and the BigDye Terminator kit, v3.1 (Thermo Fisher Scientific, Waltham, MA, USA). The bacteria were then typed using the sequences obtained in the BLAST® and SepsiTest™ BLAST databases.
3
TERT Promoter Mutation Detection by Sanger Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
TERT promoter mutation status was determined using targeted polymerase chain reaction (PCR) amplification followed by Sanger sequencing of the −424 to +64 (relative to ATG) TERT promoter region (chr5: 1 295 528 to chr5: 1 295 040 (hg19). Briefly, PCR reactions were performed in a total reaction volume of 50 μL, containing 1X AmpliTaq Gold 360 Master Mix (Cat #4398881, Life Technologies), 10 μL of 360 GC enhancer, 0.2 μM of each primer, and ~60 ng of DNA template, using primers reported in TableS1 . The PCR products were purified using MinElute PCR Purification kit (Cat #28006, Qiagen), and then sequenced by Sanger sequencing. Sanger sequencing was performed in both directions using the BigDye Terminator Kit v3.1 (Cat #4337456, Thermo) and an ABI 3130xl DNA Sequencer (Applied Biosystems).
+ Expand
TERT promoter mutation status was determined using targeted polymerase chain reaction (PCR) amplification followed by Sanger sequencing of the −424 to +64 (relative to ATG) TERT promoter region (chr5: 1 295 528 to chr5: 1 295 040 (hg19). Briefly, PCR reactions were performed in a total reaction volume of 50 μL, containing 1X AmpliTaq Gold 360 Master Mix (Cat #4398881, Life Technologies), 10 μL of 360 GC enhancer, 0.2 μM of each primer, and ~60 ng of DNA template, using primers reported in Table
4
Validating Discordant, Null, and Novel Alleles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to validate Luminex-discordant, null, and newly discovered alleles, purified PCR amplicons were sequenced using a BigDye™ Terminator kit v.3.1 (Thermo Fisher Scientific) and 3730xl DNA Analyzer (Thermo Fisher Scientific). The primers (Supplementary Table 3 ) were designed according to the genomic sequences of candidate regions using Primer-BLAST23 (link). The generated chromatogram sequence data were analyzed using BioEdit software, v.7.0.5 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html ).
5
Genotyping of AF-associated SNVs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For all participants, DNA was extracted from peripheral blood samples using the commercially available innuPREP Blood DNA Mini Kit (Analytik Jena AG, Jena, Germany) [9 (link)].
Eight SNVs previously reported to be associated with AF in genome-wide association studies (GWAS) and with a minor allele frequency (MAF) of >5% in Europeans (gnomAD v.2.0.1) were selected for genotyping (Table 1 ). The selected SNVs were not in strong linkage disequilibrium.
Genotyping was carried out by real-time PCR and high-resolution melting analysis using Rotor-Gene Q (QIAGEN N.V., Venlo, The Netherlands), as described previously [9 (link)]. Primers are available upon request. To confirm the genotyping results, 8–16 samples with different genotypes were randomly selected for Sanger sequencing using the BigDye Terminator Kit v3.1 (Thermo Fisher Scientific, Waltham, MA, USA).
Eight SNVs previously reported to be associated with AF in genome-wide association studies (GWAS) and with a minor allele frequency (MAF) of >5% in Europeans (gnomAD v.2.0.1) were selected for genotyping (
Genotyping was carried out by real-time PCR and high-resolution melting analysis using Rotor-Gene Q (QIAGEN N.V., Venlo, The Netherlands), as described previously [9 (link)]. Primers are available upon request. To confirm the genotyping results, 8–16 samples with different genotypes were randomly selected for Sanger sequencing using the BigDye Terminator Kit v3.1 (Thermo Fisher Scientific, Waltham, MA, USA).
6
Sanger Sequencing Protocol for AFLP Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm the fragments identified through NGS, Sanger sequencing of 9 AFLP markers was performed. The sequences of all primers, designed to produce amplicons 413–940 bp in length, and their annealing temperatures are shown in Table E in S1 File . The primers were custom synthesized by Integrated DNA Technologies (Coralville, IA, USA). PCR was carried out using AccuPrime SuperMix I (Thermo Fisher Scientific) under the following conditions: 94°C 2 min (94°C 15 s, annealing temperature (°C–see Table E in S1 File ) 30 s, 68°C 1 min) x 35 cycles. The products were purified with the QIAquick PCR Purification Kit (Qiagen), followed by sequencing PCR with the BigDye Terminator kit v.3.1 (Thermo Fisher Scientific): (96°C 10 s, 55°C 10 s, 60°C 4 min) x 25 cycles. The products were then purified with a DyeEx 2.0 Spin kit (Qiagen), dried using a SpeedVac SPD 111V P1 (Thermo Fisher Scientific), dissolved in 25 μl of formamide and denatured for 4 min at 96°C. Sequencing was performed on an ABI 3500 or ABI 3500xl Genetic Analyzer. Mutation Surveyor v3.10 software (Softgenetics, State College, PA, USA) was used for analysis of the obtained sequences.
7
Confirming Variant by Sanger Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The candidate variant was confirmed by capillary Sanger sequencing in all available family members. The following primers were used for confirmation of the variant: PODXL‐F1: 5′‐ATGTGTACGAGCGGCTGAAGGA‐3′. PODXL‐R1: 5′‐AGGAACCTGATGCCCAAAGAGCT‐3′. Briefly, a 1019 bp fragment was amplified using the Expand Long Template PCR System (Roche Diagnostics Corporation, Indianapolis, IN, USA), following manufacturer's recommendations. After purification with the Exostar® kit (GE Healthcare Life Sciences, Velizy‐Villacoublay, France), the PCR product was sequenced bidirectionally using the same amplification primers and the Big Dye Terminator Kit v3.1 (Thermo Fisher Scientific, Waltham, MA, USA). Sequence reactions were run on an ABI PRISM 3730xl sequencer (Thermo Fisher Scientific, Waltham, MA, USA) and analyzed on the SeqScape software (Thermo Fisher Scientific, Waltham, MA, USA).
8
Detecting Bacterial Infections in Amniotic Fluid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated from the amniotic fluid using a QIAamp DNA mini kit according to the manufacturer’s instructions.
RT-PCR was performed on a Rotor-Gene 6000 instrument using the commercial AmpliSens®C. trachomatis/Ureaplasma/M. hominis-FRT kit (Federal State Institution of Science, Central Research Institute of Epidemiology, Moscow, Russia) to detect the DNA from Ureaplasma spp., M. hominis, and C. trachomatis in the same PCR tube. As a control, we amplified beta-actin, a housekeeping gene, to exclude the presence of PCR inhibitors.
Bacterial DNA was identified by PCR targeting 16S rRNA using the following primers:5ʹ-CCAGACTCCTACGGGAGGCAG-3ʹ (V3 region) and 5ʹ-ACATTTCACAACACGAGCTGACGA-3ʹ (V6 region) [24 (link)]. The products were visualized on an agarose gel. Positive reactions yielded 950 bp products that were subsequently analyzed using sequencing. The 16S PCR products were purified and sequenced using PCR with the above primers and BigDye Terminator kit v3.1 (Thermo Fisher Scientific, Waltham, MA). The bacteria were then typed using the sequences obtained from BLAST® and SepsiTestTM BLAST.
RT-PCR was performed on a Rotor-Gene 6000 instrument using the commercial AmpliSens®C. trachomatis/Ureaplasma/M. hominis-FRT kit (Federal State Institution of Science, Central Research Institute of Epidemiology, Moscow, Russia) to detect the DNA from Ureaplasma spp., M. hominis, and C. trachomatis in the same PCR tube. As a control, we amplified beta-actin, a housekeeping gene, to exclude the presence of PCR inhibitors.
Bacterial DNA was identified by PCR targeting 16S rRNA using the following primers:
9
Bacterial 16S rRNA Gene Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial DNA was identified by PCR targeting the 16S rRNA gene with the following primers: 5′-CCAGACTCCTACGGGAGGCAG-3′ (V3 region) and 5′-ACATTTCACAACAC-GAGCTGACGA-3′ (V6 region)81 (link),82 (link). Each reaction contained 3 μL of target DNA, 500 nM forward and reverse primers, and Q5 High-Fidelity DNA polymerase (NEB, Ipswich, MA, USA) in a total volume of 25 μL. Amplification was carried out on a 2720 Thermal Cycler (Applied Biosystems, Foster City, CA, USA). The products were visualized on an agarose gel. Positive reactions yielded 950 bp products that were subsequently analyzed by sequencing. The 16S rDNA PCR products were purified and subjected to sequencing with the above-mentioned primers and the BigDye Terminator kit v.3.1 (Thermo Fisher Scientific, Waltham, MA, USA). The bacteria were then typed via searches for the obtained sequences using BLAST and SepsiTest BLAST.
10
Bacterial Identification via 16S rRNA PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial DNA was identified by PCR targeting the 16S rRNA gene with the following primers: 5′-CCAGACTCCTACGGGAGGCAG-3′ (V3 region), 5′-ACATTTCACAACACGAGCTGACGA-3′ (V6 region) [23 (link), 24 (link)]. Each reaction contained 3 μL of target DNA, 500 nM forward and reverse primers, and Q5 High-Fidelity DNA polymerase (NEB, Ipswich, MA, USA) in a total volume of 25 μL. Amplification was performed on a 2720 Thermal Cycler (Applied Biosystems, Foster City, CA, USA). The products were visualized on an agarose gel. Positive reactions yielded amplicons of 950 bp, which were subsequently analyzed by sequencing. The PCR products from 16S rRNA were cleaned and used in sequencing PCR reactions with the above primers and the BigDye Terminator kit, v3.1 (Thermo Fisher Scientific). The bacteria were then typed using the sequences obtained in BLAST® and SepsiTest™ BLAST.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!