Tb greentm premix ex taqtm 2 tli rnaseh plus

Total RNA was extracted according to manufacturer instructions, and the extracted RNA was then reverse transcribed using a PrimeScript^TM 1st Strand cDNA Synthesis Kit according to the kit instructions. Quantitative real-time PCR (qRT-PCR) was performed using TB Green^TM Premix Ex Taq^TM II (Tli RNaseH Plus) (Takara). Each 20-μl quantitative real-time PCR contained 10 μl of TB Green^TM PCR master mix, 0.2 mM of each primer, and 10 ng of cDNA with the following PCR program: 95°C for 5 min, followed by 40 cycles of 95°C for 15 s, and 62°C for 1 min in an ABI 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, United States). NtTubulin (N181029A17) was used as a house-keeping gene to investigate gene expression in transgenic tobacco lines overexpressing MzASMT 1 and WT. All gene-specific primers were designed with Primer 5 software and are listed in Supplementary Table S1. The relative abundance of the genes was determined with 2^−ΔΔCT method (Livak and Schmittgen, 2001 (link)). Each qRT-PCR analysis was repeated three times.

The PVJ1 DNA was quantified by qPCR with the primer pair PVJ1-qPCR-F/R (Table S1) targeting PVJ1 ORF81, which encodes a portal protein. To prepare a standard curve for PVJ1 DNA quantification, the PCR fragment was cloned into plasmid pEASY-T1 (TransGen Biotech, Beijing, China). The construct was then serially diluted and amplified as the known control to generate a standard curve relating the copy number of PVJ1 DNA with CT (threshold cycle) values. The standard reaction (20 μL) contained 2 μL of total DNA template, 10 μL of TB Green^TM Premix Ex Taq^TM II (Tli RNaseH Plus, Takara Bio, Shiga, Japan), 0.8 μL each of the primers (10 μM), and 6.4 μL of DNase-free water. The two-step qPCR reaction was performed on a Light Cycler fluorescence quantitative PCR instrument (Roche Life Science, Indianapolis, IN, USA) with pre-denaturation for 30 s at 95 °C, followed by 40 cycles of denaturation for 5 s at 95 °C, and annealing and extension for 30 s at 60 °C in the first step, and denaturation for 5 s at 95 °C, annealing and extension for 1 min at 60 °C, and denaturation for heating to 95 °C, and cooling to 50 °C in the second step [21 (link)].

cDNA synthesis was performed using a PrimeScript RT reagent kit (RR047A, Takara, Japan) following the manufacturer’s instructions. qRT-PCR was performed using the A PIKORed 96 (ThermoFisher, USA) with primers (listed in Table 1) and using the TB Green TM Premix Ex TaqTM II (Tli RNaseH Plus) (Takara, RR820A) as described previously [27 (link)]. The expression of each gene was first normalized to that of β-actin and was presented as a fold change by calculating the average expression level of each of the three samples divided by that of the controls at the same time point.
Table 1

Primers used in this study

Primer name	Forward primer (5′–3′)	Reverse primer (5′–3′)
β-actin	GAAGATCAAGATCATTGCTCC	TACTCCTGCTTGCTTGCGATCCA
IL-1	ATCCTCTCCAGTCAGGCTTCCTTGTG	AGCTCTTGTCGAGATGCTGCTGTGA
IL-2	TGTTGCTGGACTTACAGGTGCTCCT	CCACCACAGTTGCTGGCTCATCATC
IL-6	ACAGAGGATACCACCCACAACAGACC	CGGAACTCCAGAAGACCAGAGCAGAT
IL-18	TGCCTGATATCGACCGAACAGCCAAC	ACAGATAGGGTCACAGCCAGTCCTCT
NOD1	CTCAAAGGAGGACCTGCTGCTGGA	GAAGACAGTCTCGCCATGCTCGTTGA
NOD2	GGCAGCACAGGTGGACTCTGAGGATA	GCAGCAGCCTTAGCAGCAGTGAGTT
TNT-α	CCAGCAGGAGGGAGAACAGCAACT	CCGCCACGAGCAGGAATGAGAAGAG

Total RNA of retinas (n=8 per group) were abstracted with Trizol Reagent (Cat. #92008, Ambion, USA; 15596-018) according to the manufacturer’s instructions. Total RNA was reverse transcribed to cDNA using HiScript® Q RT SuperMix for qPCR (+ gDNA wiper) (Vazyme; R123-01). The cDNA was used as template for qPCR with TB GreenTM Premix Ex TaqTM II (Tli RNaseH Plus) (Takara; RR820A). Specific primers used in the experiment are from PrimerBank and precursor articles (Table 1). The qPCR process, a three steps reaction (95°C denature for 15s, 60°C annealing for 30s and 72°C extension for 24s), was carried out with the StepOne Plus TM Real-time PCR System (Life Technologies, Carlsbad, CA, USA). All data were chosen from the linear phase of amplification for each gene.