The polymorphisms in XRCC1 (rs25487), TP53 (rs1042522, rs12947788, rs17880604, and rs17884306), MLH1 (rs28930073), MSH2 (rs1800152, rs1802577, and rs12476364), KRAS (rs112445441, rs121913529, and rs121913530), GSTP1 (rs1695), UMPS (rs1801019), MTHFR (rs1801131, rs1801133), DPYD (rs1801159), and ABCC2 (rs2273697) were selected for genotype comparison. Genomic DNA was extracted from paraffin-embedded tissues with at least 15 slides per sample. A pathologist (X. Zhang) assessed the normal and tumor areas and the percentage of tumor cells based on hematoxylin and eosin (H&E)-stained slides. Only samples with at least 70% tumor tissue present were included for analysis. DNA was isolated using High Pure FFPET DNA Isolation Kit (Roche Applied Science, Penzberg, Germany) according to the manufacturers’ instructions. Genomic DNA concentrations, and OD260/280 and OD260/230 ratios were measured with the NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA). High-quality genomic DNA samples were then used for genotyping through the Sanger sequencing method on an ABI 3730 XL instrument (Thermo Fisher Scientific, Tempe, AZ, USA). The sequencing results were analyzed using Chromas Lite v2.1.
Abi 3730xl
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, China, France
The ABI 3730XL is a high-performance, automated DNA sequencing system. It is designed to provide efficient and reliable DNA sequencing capabilities for a wide range of applications, including genetic research, diagnostics, and drug discovery.
Automatically generated - may contain errors
Lab products found in correlation
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (12 mentions)
Bigdye terminator cycle sequencing kit, by Thermo Fisher Scientific (9 mentions)
Genemapper 4, by Thermo Fisher Scientific (9 mentions)
Powerplex 16 hs system, by Promega (7 mentions)
Qiaamp dna blood mini kit, by Qiagen (6 mentions)
Genemarker hid software, by SoftGenetics (5 mentions)
Bigdye terminator v3.1 kit, by Thermo Fisher Scientific (5 mentions)
Ta cloning kit, by Thermo Fisher Scientific (5 mentions)
Genemapper v4, by Thermo Fisher Scientific (5 mentions)
Dneasy blood tissue kit, by Qiagen (4 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (4 mentions)
Primer 5, by Premier Biosoft (4 mentions)
Bigdye terminator v1.1 cycle sequencing kit, by Thermo Fisher Scientific (3 mentions)
Qiaamp viral rna mini kit, by Qiagen (3 mentions)
Genescan 500 liz size standard, by Thermo Fisher Scientific (3 mentions)
Bigdye v3.1 chemistry, by Thermo Fisher Scientific (3 mentions)
Proflex pcr system, by Thermo Fisher Scientific (3 mentions)
Taq pcr master mix, by Mei5 Biotechnology (3 mentions)
Pgem t easy vector, by Promega (3 mentions)
Shrimp alkaline phosphatase, by Thermo Fisher Scientific (3 mentions)
295 protocols using abi 3730xl
1
Genotyping of Cancer Biomarkers
2
Germline Testing for dMMR Polyps
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Patients with a defect mismatch repair (dMMR) polyp were referred to as genetic counseling, and informed consent was signed for gene detection. DNA was extracted from leukocytes using the QIAamp DNA Mini kit (Qiagen GmbH, Hilden, German). Germline testing was targeted towards the MMR IHC pattern. Specific primer synthesis and Sanger sequencing were performed by HangZhou Zhiyuan Medical Laboratory Co., Ltd. Amplified DNA fragments included coding exons, flanking intron regions, and promoter regions. Four patients underwent Sanger sequencing by using an ABI 3730XL fully automated DNA sequencer (Thermo Fisher Scientific Inc.). Only one patient underwent next-generation sequencing (NGS) by Beijing Deyidongfang Translational Medicine Research Center Co., Ltd. InSiGHT, and at the same time, ClinVar databases were scanned to determine the significance of mutation.
3
Phylogenetic Characterization of Viral Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Our archived viral strains were isolated from clinical nasopharyngeal specimens from pediatric patients with respiratory symptoms in Japan and the Philippines, that were collected during our previous studies [13 (link),20 (link),21 (link),22 (link)]. Reverse transcription-polymerase chain reaction (RT-PCR) was conducted after nucleic acid extraction from the viral isolates, using a QIAamp MinElute Virus Spin kit (Qiagen, Hilden, Germany) [21 (link)]. The PCR amplicon was then sequenced using an ABI 3730xl with BigDye version 1.1 (Thermo Fisher Scientific, Waltham, MA, USA) to determine the nucleotide sequence of the 5′ UTR and VP1 of the viral strains, and find their phylogenetic lineage. Viral strains named Y2167/2010 and Y2071/2010 (Lineage 1), Ph364/2013 and Ph397/2013 (Lineage 2), and Ph224/2011 and Y2256/2010 (Lineage 3), were used for cloning to represent each phylogenetic lineage. Genetic sequence of the 5′ UTR of the six strains was available at GenBank (Accession number: LC477344–LC477349).
4
Fungal Identification via MALDI-TOF and ITS Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All isolates were identified at the species level using matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) conducted with Autof MS 1000 (Autobio, Zhengzhou, China) and Vitek MS (Bio Merieux, Marcy-l’Étoile, France). The species identification was confirmed via the sequencing of the rDNA internal transcribed spacer (ITS) region (ABI 3730XL, Thermo Fisher Scientific, Cleveland, OH, USA). PCR and sequencing of the amplicons were performed using the forward primers, V9G and ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′), and the reverse primers, LS266 and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) (Zhang et al., 2014 (link); Hou et al., 2016 (link)). The phylogenetic tree of D. catenulata was constructed by alignment with the ITS gene sequences of the common Candida species in the NCBI gene library. Maximum-likelihood phylogenetic trees were constructed with IQ-TREE using an ultrafast bootstrap approximation approach with 1,000 replicates (Trifinopoulos et al., 2016 (link)).
5
Detection of Sarcoma Fusion Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was reverse transcribed by a SuperScript VILO cDNA synthesis kit (Invitrogen, MA, USA), and the synthesized cDNA was subjected to PCR using the Multiplex PCR MasterMix (UNG) according to the manufacturer’s protocol. Primers for the detection of the most common fusion transcripts in STS are described in Table 1 (1 (link)). Thermocycling conditions were modified based on previously published methods (14 (link)), and the bidirectional Sanger sequencing of the PCR products was conducted on an ABI 3730XL (Thermo Fisher Scientific).
6
PCR Amplification and Sequencing of hBoV VP1/VP2 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Conventional PCR was performed to amplify a fragment of the hBoV VP1/VP2 gene region. Nucleic acid amplification was carried out using an Eppendorf Mastercycler instrument (Eppendorf, Stevenage, UK) and a Qiagen One-Step RT-PCR kit (Qiagen, Hilden, Germany) with primers/protocol described previously (Supplementary Table (available here )) [17 (link)]. The amplified products with a length of 576 base pairs (bp) corresponding to the nucleotide positions 3233–3808 in the genome of strain PK-5510 (accession number FJ170278) were analyzed by electrophoresis on 2% agarose gels stained with ethidium bromide. The amplicons were extracted and purified with a PureLink Quick Gel Extraction kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions. The purified amplicons were sequenced in both directions using the BigDye™ Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) on an ABI 3730XL (Thermo Fisher Scientific) DNA Analyser.
Partial VP1/VP2 gene nucleotide sequences of hBoV strains analyzed in this study were deposited in GenBank under the accession numbers MW759050-MW759067.
Partial VP1/VP2 gene nucleotide sequences of hBoV strains analyzed in this study were deposited in GenBank under the accession numbers MW759050-MW759067.
7
Semiquantitative MLPA for CNV Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Relative DNA copy number variation (CNV) was determined using semiquantitative MLPA. A total of 19 samples were treated, using 250 ng of DNA per sample. Initially, DNA was denatured for five min at 98°C. Then, hybridization, ligation, and amplification with end-point PCR were performed using the SALSA MLPA P380-A1 Wilms Tumor probe mix kit following the manufacturer's instructions. Reactions were performed in an MJ Mini Personal Thermal Cycler (Bio-Rad, Hercules, Cal). Finally, capillary electrophoresis was carried out in an ABI-3730XL (Thermo Fisher Scientific, Hampton, Hampshire). The obtained results were analyzed with Coffalyyser.Net.Software (MRC Holland, Amsterdam, NLD). Only deletions with values <0.7 and duplications with values >1.2 were considered. This test includes up to three probes for some genes; thus, for the analysis we consider at least two altered probes in these genes.
8
Phylogenetic Analysis of MYB Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nucleotide sequences of both strands were determined with the BigDye terminator cycle method using an ABI 3730XL (Thermo Fisher Scientific). Nucleotide sequences and the putative amino acid translations were analyzed with the BLAST program (Altschul et al., 1997 (link)). Nucleotide and amino acid sequences were aligned using ClustalW (http://clustalw.ddbj.nig.ac.jp/top-j.html ) with default settings. The amino acid alignment was used to construct a phylogenetic tree of MYB genes related to flavonoid biosynthesis (Additional File 1: Table S1 http://www.megasoftware.net/ ) (Kumar et al., 2018 (link)). Bootstrap test of 1,000 replications was performed. Nucleotide sequences of the putative promoter region (up to 1,500 bp upstream from the start codon) of two FNSII genes, GmFNSII-1 (Glyma.12G067000) and GmFNSII-2 (Glyma.12G067100) of Williams 82 were downloaded from Phytozome. Cis-acting regulatory elements of these genes were investigated using New PLACE, a database of plant cis-acting regulatory DNA elements (https://sogo.dna.affrc.go.jp/cgi-bin/sogo.cgi?lang=en&pj=640&action=page&page=newplace ), using default settings (Higo et al., 1999 (link)).
9
DNA Variant Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A DNA fragment covering the variant site was amplified using peripheral blood DNA. The primers 5’−CAATAACAACAACAGCCACCATCA−3’ (forward) and 5’−ATCATCGACGAGTACATCAAGGAG−3’ (reverse) were used to generate a product 448 bp in length. Amplification was performed with an annealing temperature of 60°C. The PCR products were then sequenced by ABI 3730XL (Thermo Fisher Scientific Inc., Waltham, USA) and analyzed using DNASTAR 5.0 software (DNASTAR, Inc., Madison, USA). The results were visualized with SnapGene Viewer (https://www.snapgene.com/snapgene-viewer/ ).
10
Phylogenetic Analysis of East Asian Hymenophyllum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
It total, we sampled 19 species, including most members of the East Asian subg. Hymenophyllum Mecodium H. imbricatum Globosa Pseudomecodium H. exsertum H. oligosorum H. pachydermicum Mecodium cpDNA ) regions from these samples were sequenced: rbcL and rps4-trnS (rps4 gene + rps4-trnS intergenic spacer). PCR reactions were each prepared in a 15 μL volume containing 20 ng genomic DNA, 1 × SuperRed PCR Master Mix RED (TOOLS, New Taipei City, Taiwan), and 0.5 μM of each primer. PCR products were then cleaned using ExoSAP-IT (Thermo Fisher Scientific, Waltham, Massachusetts, USA), and sequenced with ABI 3730XL (Thermo Fisher Scientific, Waltham, Massachusetts, USA) by the Genomics BioSci. & Tech. company (New Taipei City, Taiwan). Primers, voucher information and GenBank accession numbers are provided in the Appendices (Appendix 1 and Appendix 2 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!