Hiperfect transfection

Knockdown of XIAP and NOD1 was performed using HiPerFect Transfection (QIAGEN) of the following siRNAs: siXIAP (AAGGAATAAATTGTTCCATGC; QIAGEN), BIRC4_5 (AAGTGCTTTCACTGTGGAGGA; QIAGEN), BIRC4_8 (GGCCGGAATCTTAATATTCGA; QIAGEN), siNOD1 (Hs_CARD4_4, SI00084483; QIAGEN), siRelA (AAGATCAATGGCTACACAGGA; QIAGEN), and a non-targeting siRNA (All-Star negative control; QIAGEN).
For gene expression analysis, RT-qPCR analysis was performed. 2 μg of total RNA was transcribed into cDNA, using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). qPCR was performed using iQ SYBR Green Supermix (Bio-Rad). The following primers were used: NOD1_fwd: TCCAAAGCCAAACAGAAACTC, NOD1_rev: CAGCATCCAGATGAACGTG; GAPDH_fwd: GGTATCGTGGAAGGACTCATGAC, GAPDH_rev: ATGCCAGTGAGCTTCCCGTTCAG; and IL-8_fwd: ATGACTTCCAAGCTGGCC GTGGCT, IL-8_rev: TCTCAGCCCTCTTCAAAAACTTCTC.

An optimal siRNA (Qiagen) concentration (25 nM for siEGFR and 10 nM for siSTAT3) in HiPerFect Transfection reagent (Qiagen) was used for transfection according to the manufacturer's instructions. 48 hours post-trasfection, cells were processed for Western blot or proliferation assay.

Cells were isolated and differentiated as described above without antibiotics. Once majority of cells are attached (70–90%) exhibiting roundish macrophage/myeloid morphology (around day 4–5), cells were deemed ready for transfection. Media was aspirated gently from each well and washed twice with warm DMEM to ensure removal of floating cells. Fresh DMEM was added to a final volume of 250 μl and kept at 37°C with 5% CO₂. While incubating, 3% vol/vol of HiPerfect transfection (Qiagen) was mixed with 200 nM of NLRP3 siRNA (HS CIAS1‐6 and HS CIAS1‐9, Qiagen) or negative control siRNA (AllStars Negative Control, Qiagen) and allowed to form complexes for 20 min at room temperature. After which, the complexes were added in a dropwise manner and kept without any serum at 37°C with 5% CO₂. After 6 h, 500 μl of DMEM with 10% human serum was added and incubated overnight. Depending on the donor, another round of transfection was repeated after 24 h. To test for the levels of NLRP3 mRNA, we performed quantitative RT–PCR using RNeasy^® Plus Mini Kit (Qiagen) and primers (TGAAGAAAGATTACCGTAAGAAGTACAGA and GCGTTTGTTGAGGCTCACACT) for NLRP3 PCR amplification. The internal normalizer gene used was 18sRNA with primers CAGCCACCCGAGATTGAGCA and GCGTTTGTTGAGGCTCACACT for PCR amplification.

HK-2 (human kidney tubular cell) was obtained from China Centre for Type Culture Collection (CCTCC, China), and maintained in DMEM-F12 (Biological Industries, USA) medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. Cells were incubated in a humidified atmosphere of 95% air and 5% CO2 at 37 °C. At the case of cells treatment, recombinant human TGF-β (Peprotech, Rocky Hill, NJ) was added at cells for 48 h, with the concentration of 20 ng/ml. 100 μM rosiglitazone (Sigma-Aldrich, USA) treated cells for 48 h.
ACSL4 siRNA and control siRNA was purchased from Qiagen (Germany). Transfection was performed using HiPerFect transfection (Qiagen, Germany) according to the manufacturer’s protocol. The efficiency of transfection was assessed by the protein expression. The sequence used for knockdown of ACSL4 in this study was: 5′-TTGGAGCGATTTGAAATTCCA -3′. HK-2 cells treated with or without TGF-β, as well as the cells transfected with ACSL4 siRNA for 48 h.

siRNA specially targeting Nqo1-AS1 (Nqo1-AS1 siRNA) and scrambled negative control siRNA (siRNA CTL) were synthesized by GenePharma (Shanghai, China).The Nqo1-AS1 siRNA sequence was 5′-GCA​UGU​UGC​UGU​GUG​CCU​ATT-3′ and the siRNA CTL sequence was 5′-UUC​UCC​GAA​CGU​GUC​ACG​UTT-3′. A 20 μM siRNA solution was transfected into the mle-12 cells using HiPerFect Transfection (Qiagen) according to the manufacturer’s instructions. After 24 h, more than 95% of the mle-12 cells were still viable. Cells were then treated with 0 and 0.5% CSE for 24 h prior to being collected, and analyzed.