Thermocycler

The low virulent strain DT-Ab022 (LV) and high-virulent strain DT-Ab057 (HV) were cultured at 37°C for 16 hours in LB broth media, then total RNA was extracted using RNA extraction kit (Qiagen, Germany) according to the manufacturer’s directions. The RNA was subsequently treated with RNase-free DNase I (Qiagen, Germany) to degrade all genomic DNA. Complementarity DNA synthesis was performed using the PrimeScript RT reagent kit (Takara, Japan) according to the manufacturer’s directions. PCR was performed using the following primers (F1: CATTAACAACCGTGGCAATG;F2: CTATGACCGCTGGAAACCG; R: GTTAGTGCCGTGGTCTT), the PCR products were annealed at 55°C for 30 cycles using Thermocycler (Thermo Scientific, US).

DNA was extracted from the buffy coat using the QIAamp DNA blood kit (QIAGEN, Germany) following to the manufacturer’s protocol. DNA yields and quality were determined using the NanoVue Plus UV spectrophotometer (GE Healthcare, USA).
Genotyping of GC SNPs rs4588 and rs7041 were carried out by restriction fragment length polymorphism (RFLP) technique. PCR was performed using a thermocycler (Thermo Fisher Scientific, USA). The PCR reaction mixture was prepared in a total volume of 20 μL: 10 μL of 2X GoTaq® G2 Green Master Mix (Promega, USA), 1 μL each of 10 nmol forward primer (5′-AAATAATGAGCAAATGAAAGAAGAC-3′) and reverse primer (5′- CAATAACAGCAAAGAAATGAGTAGA-3′), 3 μL of nuclease-free water and 5 μL of DNA (15 ng/μL). The PCR conditions for amplification included an initial step of denaturation at 95 °C for 10 min followed by 35 cycles of denaturation at 95 °C for 45 s, annealing at 51 °C for 45 s and elongation at 72 °C for 45 s, and finally a step of final extension step at 72 °C for 7 min. The PCR product, a 483-bp fragment was then digested separately using restriction enzyme, HaeIII (for rs7041) and StyI (for rs 4588) (New England Biolabs Inc., USA) in a total reaction volume of 20 μL. The digested products were then evaluated by electrophoresis on 1.5% agarose gel stained with ethidium bromide.

The RNA was extracted from the rumen, jejunum, and liver tissue samples by using a miRNeasy Mini Kit (Qiagen Inc.) according to the manufacturer’s instruction. The yield of the total RNA was then measured using a Qubit (Invitrogen, Carlsbad, CA, United States). RNA was reverse-transcribed by High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, CA, United States) according to the manufacturer’s guide. cDNA was synthesized in a Thermo-cycler (Thermo Fisher Scientific) with 25°C for 10 min, 37°C for 120 min, and 85°C for 5 min, followed by a 4°C hold to stop the reaction.

Total RNA containing miRNA was used as the starting material. Mature miRNA was reverse-transcribed into cDNA using miScript II RT kit (Qiagen Inc.). Briefly, template RNA was thawed on ice and 10x miScript Nucleics mix, 5x miScript HiSpec buffer and RNase-free water were thawed at room temperature. Reaction components for a 20-μL reaction were 4 μL of HiSpec buffer, 2 μL of Nucleics mix, 2 μL of reverse transcriptase enzyme mix, and 12 μL of RNA template (containing 300 ng RNA plus water). Reverse-transcription reaction components were gently mixed, briefly centrifuged (2000 × g for 10 s) and kept on ice. The mixture was incubated at 37 °C for 60 min and then at 95 °C for 5 min in a Thermocycler (Thermo Fisher Scientific). After incubation, the reaction mix was placed on ice, diluted with 90 μL nuclease-free water, and stored at −20 °C prior to real-time PCR.

The design of DNA substrates followed those reported by Marintchev et al.^{21 (link)}. DNA oligonucleotides were purchased from Integrated DNA Technologies. DNA substrates used for binding studies were generated by annealing complementary oligos (Supplementary Fig. S4). The bottom 39 base strand was 3′ end-labelled with 6-FAM for detection. Oligos were dissolved in water and annealed using a thermocycler (Thermo Scientific) with a temperature gradient from 100 to 25 °C and cooling rate of 1 °C/min. Annealed oligos were purified using a 1 mL MonoQ ion exchange column (GE Healthcare), equilibrated with 20 mM Tris pH 8.0 and resolved with a gradient of 0–1 M KCl. Purified DNA substrates were buffer exchanged (10 mM Tris pH 8.0, 1 mM EDTA) using ultrafiltration (Nanosep, Pall Corporation) and stored at −20 °C.