Gv492 vector

We constructed shRNA-TMEM158 sequences (sh-1, 5′-ccTGCCCAACGGCATGGAACA-3′; sh-2, 5′-gcATTTCTGCTGCCTAGACTT-3′) using the GV493 vector, and a scramble sequence (5′-TTCTCCGAACGTGTCACGT-3′) was designed as a negative control. We also constructed a TMEM158-overexpressing plasmid using the GV492 vector (GeneChem, China). Lentiviral transfection was conducted according to the manufacturer’s manual. After infection, U87MG, U251MG, and TJ905 cells were selected using 2.00 μg/ml puromycin solution. Plasmids were purchased from Hanbio (China). A STAT3-overexpressing plasmid was constructed using the pcDNA3.1 vector. Plasmids were transiently transfected into cells using Lipofectamine 3000 (Invitrogen, US).

To construct a shRNA vector to knockdown CLSTN1, we used a lentiviral vector GV118 (Shanghai Genechem Co, Ltd.) and determined that the best target sequence is 5′-TAGTGAAGATAAGCGTCAA-3′ (Figure S1 and Table S1). The scrambled control sequence for shRNA (5′-TTCTCCGAACGTGTCACGT-3′) (control shRNA) was also expressed from the GV118 vector and did not target any known mouse cDNA sequence. The full length of CLSTN1 was amplified using a forward primer (5′-AGGTCGACTCTAGAGGATCCCGCCACCATGCTGCGCCGCCCTGCGCCCGCGCTG-3′) and a reverse primer (5- TCCTTGTAGTCCATACCGTAGCTGAGTGTGGAGTCATCCCATTCCAGCTGTC-3′). Amplified CLSTN1 cDNA was ligated into the GV492 vector (Shanghai Genechem Co., Ltd.) to obtain the EGFP-CLSTN1-lentiviral vector. The full length of ICAM5 was amplified using a forward primer (5′-GAGGATCCCCGGGTACCGGTCGCCACCATGCCGGGGCCTTCGCCAGGGCTGC-3′) and a reverse primer (5′-CACACATTCCACAGGCTAGTCAGGAAGATGTCAGCTGGATAGC-3′). Amplified ICAM5 cDNA was ligated into the GV326 vector (Shanghai Genechem Co., Ltd.) to obtain the Cherry-ICAM5-lentiviral vector.

To construct a plasmid expressing SLC12A5, the coding sequence of human SLC12A5 (NM_020708) was synthesized and cloned into the GV492 vector (Genechem, Shanghai, China). Lentivirus is used to pack the plasmid containing the SLC12A5 gene and co-transfected into 293 T cells. After purification of lentivirus and quality inspection, the lentivirus contain SLC12A5 gene were transfected into cells. The stably transfected cells were screened under 2 μg/ml puromycin (Biosharp, China) selection for 1 week and 1 μg/ml puromycin was to maintain selection pressure on stably transfected. For SLC12A5 knockdown, 5 μL siRNA (20 μM, GenePharma, Shanghai, China) were transfected into cells with 5 μL Lipofectamine 2000 (Invitrogen) in 6-well plates. For YTHDC1 knockdown, shRNA and corresponding control lentiviruses were synthesized by GeneChem (Shanghai, China). SLC12A5 siRNA and YTHDC1 shRNA target sequences were shown in Supplementary Table S1.

The PRDM16 sequence was synthesized and subcloned into a GV146 vector (GENECHEM Co., Ltd., Shanghai, China). PC overexpression plasmid was bought from GENECHEM Co., Ltd. (Shanghai, China), and the GV492 vector was used as a negative control. PC-siRNAs were designed and synthesized by Biotend Co., Ltd. (Shanghai, China). The sequences of PC-siRNAs are listed in Supplementary Table 2. The cells were incubated for 48 h before use in assays. Human pGL3-PC-promoter and four truncated segments of pGL3-PC-promoters for the luciferase assay were constructed by GENEWIZ Co., Ltd. (Suzhou, China). Plasmids were transfected into cells using Hieff Trans Liposomal Transfection Reagent (Yeasen, Shanghai, China) according to the manufacturer’s protocol. We adopted the qRT-PCR assay and Western blotting to evaluate overexpression of PRDM16. PC overexpression and knockdown efficiency were tested using qRT-PCR. BCPAP^PRDM16–OE and BCPAP^PRDM16–NC cell lines were filtrated from BCPAP cells transfected with PRDM16 overexpression plasmids or the negative control vector using 200 μg/ml neomycin and cultured with RPMI-1640 with 100 μg/ml neomycin. The stable cell lines were identified using fluorescence microscope for green fluorescence to ensure the transfection efficiency was more than 90%.