Cfx96 real time pcr machine

Manufactured by Bio-Rad

Sourced in United States, China, Japan, Germany, Canada, India

The CFX96 real-time PCR machine is a laboratory equipment designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It is capable of detecting and quantifying DNA or RNA targets in a sample during the amplification process. The machine utilizes fluorescent detection technology to monitor the progress of the reaction in real-time.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

CFX96 (2302 citations) CFX96 machine (190 citations) CFX96 Real-Time PCR (107 citations) PCR machine (73 citations) CFX96 PCR machine (59 citations) CFX96 Touch Real-Time PCR machine (59 citations) CFX96 Real-Time machine (18 citations) CFX96 real-time PCR detection machine (10 citations) CFX96 Touch Real-Time PCR Detection machine (5 citations) CFX96 Real-time PCR Detection System machine (3 citations)

218 protocols using cfx96 real time pcr machine

RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction was performed using Trizol (Invitrogen) according to the manufacturer's instructions. RT-qPCR was performed on cDNA generated from 1 μg DNaseI-treated total RNA using SuperScript® III First-Strand Synthesis System (Invitrogen), according to the manufacturers’ instructions. RT-qPCR reactions were prepared in 20 μl volumes containing 1× IQ SyberGreen supermix and 0.3 μM of the respective forward and reverse primers. Samples were amplified and analysed using the CFX96^(TM) Real Time PCR Machine (Bio-Rad).
The expression of known miRNAs was measured using TaqMan® MiRNA assays (Applied Biosystems) according to the manufacturer's instructions. Normalisation for cDNA input was performed using a stably expressed reference snoRNA, RNU24.

Wong J.J., Au A.Y., Gao D., Pinello N., Kwok C.T., Thoeng A., Lau K.A., Gordon J.E., Schmitz U., Feng Y., Nguyen T.V., Middleton R., Bailey C.G., Holst J., Rasko J.E, & Ritchie W. (2016). RBM3 regulates temperature sensitive miR-142–5p and miR-143 (thermomiRs), which target immune genes and control fever. Nucleic Acids Research, 44(6), 2888-2897.

+ Open protocol

+ Expand

Thermal Shift Assay for PD-L1

Check if the same lab product or an alternative is used in the 5 most similar protocols

Thermal melting experiments
were carried out using a CFX96TM real-time PCR machine (BioRad). Protein
thermal unfolding was monitored by the increase in the fluorescence
of the SYPRO orange dye. To perform DSF experiments, 20 μM PD-L1
long, 20× SYPRO orange dye (Thermo Fisher Scientific, U.K.),
and 0.1 mM compound in 10 mM Tris-HCl, pH 8.0, containing 20 mM NaCl
were added to 96-well polymerase chain reaction (PCR) plates with
a final volume of 40 μL. Subsequently, the samples were heated
in a PCR system from 25 to 95 °C at a rate of 0.4 °C/10
s. Fluorescence intensities were monitored with 492 nm excitation
and 610 nm emission. Control wells were used to compare the melting
temperature (T_m) without fragments [replaced
by the same amount of dimethyl sulfoxide (DMSO)] and with 0.1 mM BMS-1166 as a positive control. T_m values were obtained from the maximum value of first derivative
(dF/dT) plots of the unfolding protein
curves and then analyzed in Microsoft Excel. Experiments were performed
in triplicate. Thermal shift values (ΔT_m) were obtained through subtraction of the unfolding temperature
of the PD-L1 ectodomain in the presence of 2% (vol/vol) DMSO (T_mDMSO) from unfolding temperatures of the PD-L1 ectodomain
in the presence of fragment (T_mfr), according
to the following equation: ΔT_m [°C]
= T_mfr – T_mDMSO.

Kitel R., Rodríguez I., del Corte X., Atmaj J., Żarnik M., Surmiak E., Muszak D., Magiera-Mularz K., Popowicz G.M., Holak T.A, & Musielak B. (2022). Exploring the Surface of the Ectodomain of the PD-L1 Immune Checkpoint with Small-Molecule Fragments. ACS Chemical Biology, 17(9), 2655-2663.

+ Open protocol

+ Expand

Quantitative Analysis of PEP1 Response Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative real-time polymerase chain reaction (qRT-PCR) assessments were carried out to analyze the relative transcript levels of the PEPR1, PEPR2, ACS6, MYB51, WRKY11, ZAT12, and PER5 genes following a treatment with 1 μM of PEP1. To prepare the sample, five DAT seedlings grown on half MS plates were incubated in liquid half MS with or without 1 μM PEP1 for 6 h. After treatment, amounts of approximately 100 mg of root tissues were harvested per biological replicate and snap-frozen in liquid nitrogen. Total RNA was extracted using RNeasy plant mini kits (Qiagen, Germany) according to the manufacturer’s instructions. The quality and quantity of the isolated RNA samples were analyzed by Nanodrop^TM spectrophotometry (GE Healthcare, USA). Approximately 2 μg of purified RNA was used as a template for cDNA biosynthesis using SuperScript^TM III Reverse Transcriptase (Invitrogen, USA) in 20 μl reaction amounts. The synthesized cDNA was diluted five-fold with autoclaved distilled H2O, and 1 μl of c-DNA was used as a template for qRT-PCR using iQ^TM SYBR^® Green Supermix (Bio-Rad, USA) on a CFX96^TM Real-Time PCR machine (Bio-Rad) following the manufacturer’s instructions, as previously reported (Kim et al., 2020 (link)). The sequence information of the gene-specific primers is listed in Supplementary Table S1.

Dhar S., Kim H., Segonzac C, & Lee J.Y. (2021). The Danger-Associated Peptide PEP1 Directs Cellular Reprogramming in the Arabidopsis Root Vascular System. Molecules and Cells, 44(11), 830-842.

+ Open protocol

+ Expand

Real-Time PCR Gene Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol was used for RNA isolation (Invitrogen), and RNA purity/quantity was determined by spectroscopy. For real‐time PCR, RNA was used to make cDNA with SuperScript II reverse transcriptase (Invitrogen). The SsoFasr^TM Probes Supermix (Bio‐Rad) was used to perform triplicate 20 μL PCR reactions using specific primer/probe sets as well as a 35 cycle protocol with a Bio‐Rad CFX96^TM Real‐time PCR Machine. The standard 2^−ΔΔCt method was used to assess changes in expression. The primers are list as followed: ICAM‐1: forward, 5′‐CAATTTCTCATGCCGCACAG‐3′, reverse, 5′‐AGCTGGAAGATCGAAAGTCCG‐3′; iNOS: forward, 5′‐GCAGAATGTGACCATCATGG‐3′, reverse, 5′‐ACAACCTTGGTGTTGAAGGC‐3′; p67phox, forward, 5′‐TTCCATCCCCAAATGCAAAG‐3′, reverse, 5′‐TCAGATGCCCTAAAACCGGAG‐3′; Gp91phox, forward, 5′‐GACCATT GCAAGTGAACACCC‐3′, reverse, 5′‐AAATGAAGTGGACTCCACGCG‐3′; β‐actin, forward, 5′‐GATGGCCACGGCTGCTTC‐3′, reverse, 5′‐TGCCTCAGGGCAGCGGAA‐3′.

Yin L., Fang Y., Song T., Lv D., Wang Z., Zhu L., Zhao Z, & Yin X. (2019). FBXL10 regulates cardiac dysfunction in diabetic cardiomyopathy via the PKC β2 pathway. Journal of Cellular and Molecular Medicine, 23(4), 2558-2567.

+ Open protocol

+ Expand

Transcriptional Profiling of Ischemic Stroke

Check if the same lab product or an alternative is used in the 5 most similar protocols

At 24 h following stroke or sham surgery, mice were euthanized by isoflurane overdose and perfused with RNase-free phosphate-buffered saline (PBS). After removing the cerebellum and olfactory bulbs, the brain was separated into left and right hemispheres and snap-frozen in liquid nitrogen for RNA extraction. Spleens were also removed, cut in half and snap-frozen in liquid nitrogen. Tissues were stored at − 80 °C until required. Total RNA was extracted using Qiazol^® reagent (Qiagen) and the RNeasy Mini Kit with on-column DNase step (Qiagen) followed by cDNA conversion using the Quantitect Reverse Transcription kit (for Taqman^® gene expression assays; Qiagen). The cDNA was then used as a template in real-time PCR to measure mRNA expression of Vdr, Cyp27b, Cyp24a, Cxcl12, Tbx21, Stat4, Rorc, Gata3, Stat6, Foxp3, Tnfα, Il1β, Il6, Il21, Il23a, Tgfβ1, Ccl2, Ccl5, Gp91phox, Mrc1, Il10 and Icam1. Gapdh and β-actin were assessed as housekeeping genes for brain and spleen tissue, respectively. Assays were performed according to the manufacturer’s instructions using the Bio-Rad CFX96TM real-time PCR machine (Bio-Rad). Data were normalized to the housekeeping gene and calculated as change in fold expression relative to sham using the formula: fold-change = 2^−ΔΔCt.

Evans M.A., Kim H.A., Ling Y.H., Uong S., Vinh A., De Silva T.M., Arumugam T.V., Clarkson A.N., Zosky G.R., Drummond G.R., Broughton B.R, & Sobey C.G. (2018). Vitamin D3 Supplementation Reduces Subsequent Brain Injury and Inflammation Associated with Ischemic Stroke. Neuromolecular Medicine, 20(1), 147-159.

+ Open protocol

+ Expand

Quantitative Analysis of Immune Markers in Murine Stroke

Check if the same lab product or an alternative is used in the 5 most similar protocols

Some mice (n = 44) were killed by isoflurane inhalation overdose and perfused with sterile PBS (50 ml) via the left ventricle prior to decapitation and brain removal. Hemispheres were separated and immediately frozen in liquid nitrogen. Total RNA was extracted with TRIzol reagent (Thermofisher Scientific, USA) and RNeasy Mini Kit (Qiagen, Germany) followed by cDNA conversion with Quantitect Reverse Transcription kit (Qiagen). Quantitative RT-PCR was performed with TaqMan Gene expression primers (Applied Biosystems, USA) including Il-1b, Tnf-a, Il-23a, Il-12a, Foxp3, Chil3, Il-10, Il-13, Tgfb, and IL-37 using Bio-Rad CFX96TM real-time PCR machine (Bio-Rad, USA). Data were expressed as fold change (2^−ΔΔCT) relative to WT sham-operated mice, with the exception of IL-37 in stroke-operated mice, which was normalized to IL-37tg sham-operated mice.

Zhang S.R., Nold M.F., Tang S.C., Bui C.B., Nold C.A., Arumugam T.V., Drummond G.R., Sobey C.G, & Kim H.A. (2019). IL-37 increases in patients after ischemic stroke and protects from inflammatory brain injury, motor impairment and lung infection in mice. Scientific Reports, 9, 6922.

+ Open protocol

+ Expand

Cortical Tissue Extraction and Gene Expression Analysis in mTBI Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

mTBI and control mice received an intracardiac perfusion with saline. Afterward, 2 × 2 × 2 mm cube of superficial cortical tissue and meninges was removed. This included the mTBI lesion as well as some surrounding brain tissue. The tissue was snap frozen using dry ice. Total RNA was extracted with a Qiagen Micro RNA kit (Qiagen) following the manufacturer’s protocol. RNA quantity and integrity were assessed using a spectrophotometer (Nanodrop One, Thermoscientific). cDNA was generated using an iScript cDNA Synthesis kit (Bio-Rad). Pre-made commercial and custom made PrimePCR plates were used for qPCR experiments (Angiogenesis M96, Type I interferon response M96, type I interferon custom-made plate; Bio-Rad) (see Supplementary Table 1 for individual genes). qPCR was performed using universal SYBR Green Supermix (Bio-Rad) and cDNA template or water (non-template negative control) at an annealing temperature of 60°C with a CFX96 Real-Time PCR machine (Bio-Rad). PCR products were subjected to melt analysis to confirm purity after DNA amplification. For each gene, expression values were normalized to the Gapdh housekeeping gene. The resulting relative gene expression was then expressed as a fold-change from uninjured control samples (δδCT).

Mastorakos P., Russo M.V., Zhou T., Johnson K, & McGavern D.B. (2021). Antimicrobial immunity impedes CNS vascular repair following brain injury. Nature immunology, 22(10), 1280-1293.

+ Open protocol

+ Expand

Quantitative Analysis of Amph Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Larval brains (n = 15 for each condition) was dissected in PBS at indicated developmental stages. Total RNA was isolated by a Quick-RNA MiniPrep kit (R1054, Zymo Research). Reverse transcription was performed with oligo dT-primers using SuperScript® III First-Strand Synthesis System (18080051, Invitrogen) and Quantitative Real-Time PCR (qRT-PCR) using the cDNA was performed with SsoAdvanced Universal SYBR® Green Supermix (1725271, Bio-Rad Laboratories) on a Bio-Rad CFX96 Real-Time PCR machine. Experiment was independently repeated four times. All samples and standards were assayed in triplicates. Expression levels of Amph were normalized to those of GAPDH.
Primers for qRT-PCR:
Amph: ACTAAGACCAGCACAGGCAC, TCACCCGGTACAGAACTCCA;
GAPDH: TAAATTCGACTCGACTCACGGT, CTCCACCACATACTCGGCTC.

Sheng C., Javed U., Gibbs M., Long C., Yin J., Qin B, & Yuan Q. (2018). Experience-dependent structural plasticity targets dynamic filopodia in regulating dendrite maturation and synaptogenesis. Nature Communications, 9, 3362.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from colon tissues using TRIzol reagent (Solarbio, Beijing, China) according to the manufacturer's protocol. First-strand cDNA was synthesized using a reverse transcription kit (Foregene, Chengdu, China) according to the manufacturer's instructions. qRT-PCR was performed with Easy^TM-SYBR Green Master Mix (Foregene, Chengdu, China) using a CFX96 real-time PCR machine (Bio-Rad). PCR was performed under the following conditions: 95°C for 10 min, 40 cycles of 15 s at 95°C, 30 s at 52–60°C (based on the target), and 45 s at 72°C. Data were normalized to GAPDH, and the relative expression levels of the genes were calculated using the 2^−ΔΔCt method. Detailed primer sequences are shown in Table 2.

Zhu X., Yang Y., Gao W., Jiang B, & Shi L. (2021). Capparis spinosa Alleviates DSS-Induced Ulcerative Colitis via Regulation of the Gut Microbiota and Oxidative Stress. Evidence-based Complementary and Alternative Medicine : eCAM, 2021, 1227876.

+ Open protocol

+ Expand

Quantitative Analysis of PMI Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted using a TRIzol reagent (Sigma-Aldrich) according to manufacturer’s instructions. RNA concentrations were measured using a DeNovix DS-11 spectrophotometer. Total RNA (1 μg) was reverse transcribed into cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA), according to manufacturer’s instructions.
Primer sequences used to detect PMI transcripts (Macrogen, Seoul, Republic of Korea) are 5′-ATGTGCCAACCCTGTGTGAA-3′ for the forward sequence and 5′-TTCATGGCACACGAAGGACA-3′ for the reverse sequence. The sequences for β-actin (Macrogen) are 5′-CTCACCATGGATGATGATATCGC-3′ for the forward sequence and 5′-AGGAATCCTTCTGACCCATGC-3′ for the reverse sequence. Real-time PCR amplification reactions were performed using iTaq™ Universal SYBR^® Green Supermix (Bio-Rad), and real-time PCR was performed using a CFX96 Real-Time PCR machine (Bio-Rad). Analysis was performed using the 2^−∆CT method.

Al Hadeethi S., El-Baba C., Araji K., Hayar B., Cheikh I.A., El-Khoury R., Usta J, & Darwiche N. (2023). Mannose Inhibits the Pentose Phosphate Pathway in Colorectal Cancer and Enhances Sensitivity to 5-Fluorouracil Therapy. Cancers, 15(8), 2268.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!