Clc main workbench

Candidate variants were verified by Sanger sequencing in all available family members to establish genotype-phenotype correlation. Primer design and sequence analysis were performed in CLC Main Workbench (CLC bio, Aarhus, Denmark); the sequencing was carried out using standard procedures and sequenced on the ABI3130XL (Life Technologies Ltd., Paisley, UK) as previously described [2 (link)].

Guide sequence 5′CTGGTAGCGGCGCTGTTGCT3′ targeting exon 1 of CD47 was inserted into the pX330 CRISPR-Cas9 plasmid^{26 (link)}. Jurkat cells were nucleofected (Amaxa Nucleofector II, Lonza) with this plasmid, cultured for 1 week, and clonally sorted for CD47^−/− cells (named JC47 for Jurkat CRISPR CD47) by flow cytometry. Loci targeting in candidate clonal populations was confirmed by sequencing the genomic amplicon generated by polymerase chain reaction (PCR) using the primers: 5′GACAGGAACGGGTGCAATGA3’ and 5′TAATTTTTGCGCGAGGTGCG3′. Analyses were performed using CLC Main Workbench (CLC Bio) by alignment of CRISPR mutants to the parental amplicon sequence.
The expression construct for CD47 isoform 4 (pKS336-hCD47iso4) was provided by Dr. Ohdan (University of Hiroshima)^{27 (link)}. CD47iso1 and iso2, with shorter cytoplasmic domains, were generated from CD47iso4 using PCR, and re-inserted into the pKS336 backbone. CD47^−/− cells were nucleofected and serially sorted by flow cytometry to obtain clonal populations of CD47-expressing cells.

Genome data from Gmm, Gpd, Glossina austeni (Gau), Gff and Glossina brevipalpis (Gbr) were obtained from Vectorbase (https://www.vectorbase.org/). For SG transcriptome, we used both EST and Illumina data [36 (link), 37 (link)]. Transcriptome denovo assembly and mapping were analyzed using CLC Genomics Workbench (CLC bio, Cambridge, MA). Blast, genome annotation and sequence alignment were performed by CLC Main Workbench (CLC bio, Cambridge, MA). The published Gmm TSGF sequences and Drosophila melanogaster (Dm) sequences were used to identify homologs in other Glossina species by Blast. The ADA motif associated with each homolog was verified by BlastP analysis. Signal peptides were predicted by SignalP (http://www.cbs.dtu.dk/services/SignalP/). Phylogenic trees were generated using CLC Main Workbench. Jukes Cantor method was used to measure the protein distance and Neighbor Joining method was used to generate the tree. Bootstrap analysis was performed by 1000 replicates.

Amplification of the fur gene was performed as previously described (Machado and Gram, 2015 (link)), with few changes. Briefly, amplifications were performed in a total volume of 25 μL using 5 ng final concentration of genomic DNA as template, 0.2 μM of each primer [fur_AP_fw and fur_AP_rv (Machado and Gram, 2015 (link))] and TEMPase Hot Start Master Mix Blue (Ampliqon A/S, Odense, Denmark), following the producers instructions. The PCR amplification was carried out in a thermal cycler (Applied Biosystems^® Veriti^® 96-Well Thermal Cycler) as follows: 15 min initial denaturation step at 95°C, followed by 30 cycles of 95°C for 25 s, 52°C for 25 s, and 72°C for 1 min, with a final extension step of 5 min at 72°C. The amplified products were visualized after agarose gel electrophoresis (1%) and ethidium bromide staining. The PCR products were enzymatically purified by treatment with Exonuclease I (ExoI) (Thermo Scientific) and FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific) before being sequenced by Macrogen (Macrogen Europe, Amsterdam, The Netherlands). The sequencing reads were assembled and analyzed using CLC Main Workbench (CLC Aarhus, Denmark version 7).

Coding sequences of the six HR-like proteins At5G43460, At4G14420, At1G04340, At3G23175, At3G23180, and At3G23190 were retrieved from The Arabidopsis Information Resource (TAIR, www.arabidopsis.org) and aligned using the create alignment function of CLC Main Workbench (Version 7.6.1, Quiagen Aarhus A/S). The identity at the amino acid level was obtained by aligning the corresponding protein sequences and the pairwise comparison function of the program. The coding sequences were aligned using the ClustalW algorithm in JalView2 (Waterhouse et al., 2009 (link)) and a phylogenetic tree was generated using percentage identity from the Gblocks processed alignment.