Anti lbpa

Manufactured by Merck Group

Sourced in United Kingdom

Anti-LBPA is a laboratory reagent used to detect and quantify the presence of LBPA (Lysobisphosphatidic acid) in biological samples. It functions as a specific antibody that binds to LBPA, allowing for its identification and measurement.

Automatically generated - may contain errors

Lab products found in correlation

Anti gm130, by BD (2 mentions) Anti tubulin, by Merck Group (1 mentions) Anti gapdh, by Merck Group (1 mentions) A8717, by Merck Group (1 mentions) Mabt837, by Merck Group (1 mentions) Anti eea1, by BD (1 mentions) Ab37615, by Abcam (1 mentions) Ab2733, by Abcam (1 mentions) Anti vps35, by Santa Cruz Biotechnology (1 mentions) Sc 374 372, by Santa Cruz Biotechnology (1 mentions) Sig 39320, by Fortrea (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Bovine serum albumin (bsa), by Merck Group (1 mentions) Alexa fluor 546, by Thermo Fisher Scientific (1 mentions) Alexa fluor 488, by Thermo Fisher Scientific (1 mentions) Fv3000 confocal microscope, by Olympus (1 mentions) Anti lamp1 antibody, by Abcam (1 mentions)

3 protocols using anti lbpa

Comprehensive Antibody Panel for Alzheimer's Research

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anti-M6PR (cation independent) antibody [2G11] (ab2733; Abcam).
Anti-APP (A8717; Sigma).
Anti-APP 6e10 to detect Aβ, sAPPα (SIG-39320; Covance).
Anti-GAPDH (Sigma).
Anti-tubulin (Sigma).
Anti-cyclophilin B (ACB0825; Atgen).
Anti-sAPPβ Swedish (6A-1; IBL).
Anti-VPS35 (SC-374372; Santa Cruz).
Anti-LAMP-1 (SC-18821; Santa Cruz).
Anti-PLD3 (HPA012800; Sigma).
Anti-transferrin receptor (13-6800; Invitrogen).
Anti-SORL1 (612633; BD Bioscience).
Anti-GFP (Seaman lab).
Anti-LBPA (MABT837; Sigma).
Anti-EEA1 (610456; BD Biosciences).
Anti-GM130 (610822; BD Biosciences).
Anti-TGN46 (Seaman lab).
Anti-MICALL1 (H00085377-B01P, Novus).
Anti-SNAP29 (gift from Andrew Peden, University of Sheffield, UK).
Anti-PACSIN2 (ab37615, Abcam).

Mukadam A.S., Breusegem S.Y, & Seaman M.N. (2018). Analysis of novel endosome-to-Golgi retrieval genes reveals a role for PLD3 in regulating endosomal protein sorting and amyloid precursor protein processing. Cellular and Molecular Life Sciences, 75(14), 2613-2625.

+ Open protocol

+ Expand

Caspase-2 RNAi knockdown in U87MG and IMR90-E1A cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

U87MG and IMR90-E1A cells were grown in DMEM supplemented with 10% FBS, penicillin (100 U/mL), glutamine (2 mmol/L), and streptomycin (100 µg/mL) at 37°C in 5% CO₂ atmosphere. RNA oligos for interference (RNAi) were purchased from Dharmacon: CASP2 RNAi1, AAACAGCUGUUGUUGAGCGAA; Control1 (CASP2 mutated) RNAi, AAACAAUUGUUGUUGAGCGAA; or Qiagen: CASP2 RNAi2 CAUCUUCUGGAGAAGGACATT and a non-targeting siRNA UUCUCCGAACGUGUCACGU, Control2. Cells were transfected 24 hours after plating by adding the Opti-MEM medium containing Lipofectamine 2000 (Invitrogen) plus RNAi oligos. BSA and Filipin (Sigma), anti-LBPA [15] (link), anti-transferrin receptor (Tnf-R) (OKT9), anti-GM-130 (BD biosciences), anti-caspase-2 [16] (link). Secondary anti-mouse and anti-rabbit antibodies were Alexa Fluor 488 and Alexa Fluor 546 conjugated (Invitrogen).

Picco R., Tomasella A., Fogolari F, & Brancolini C. (2014). Transcriptomic Analysis Unveils Correlations between Regulative Apoptotic Caspases and Genes of Cholesterol Homeostasis in Human Brain. PLoS ONE, 9(10), e110610.

+ Open protocol

+ Expand

Macrophage Vesicle Trafficking Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Macrophages differentiated from PBMCs on cover slips were treated with RBCEVs and fixed at different timepoints with 10% formalin. The cells were then washed with PBS containing 2% FBS prior to permeabilization with 0.1% Triton X‐100. The cells were then incubated with the appropriate primary antibody against markers for EEA, late endosomes, or lysosomes‐late endosomes (i.e., EEA, LBPA and LAMP1, respectively), followed by incubation with the appropriate secondary antibody (AlexaFluor 488/594/647‐conjugated mouse I) prior to imaging with the Olympus FV3000 confocal microscope (Olympus Corporation). Primary antibodies used for immunofluorescent staining were anti‐LAMP1 antibody (Abcam, Cat #: ab25630 or Cell Signaling Technology, Cat #: 9091S), anti‐EEA antibody (Cell Signalling Technology, Cat #: 2411S), anti‐LBPA (Sigma‐Aldrich, Cat #: MABT837), anti‐SLC48A1 (HRG1) (Thermofisher Scientific, Cat #: PA5‐42191), and anti‐human BAND 3 (Santa Cruz Biotechnology, Cat #: sc‐133190)

Pham T.T., Le A.H., Dang C.P., Chong S.Y., Do D.V., Peng B., Jayasinghe M.K., Ong H.B., Hoang D.V., Louise R.A., Loh Y., Hou H.W., Wang J, & Le M.T. (2023). Endocytosis of red blood cell extracellular vesicles by macrophages leads to cytoplasmic heme release and prevents foam cell formation in atherosclerosis. Journal of Extracellular Vesicles, 12(8), 12354.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!