Total RNA of mEB8 and primary HCPs were isolated using trizol (9018; Takara). First-strand cDNA was synthesized from 500ng of RNA using PrimeScript RT reagent Kit (RR037A; Takara). Real-time PCR assay for NLRP12, GR-1, CD11b, NIK, ERK1/2, and β-actin was performed using SYBR Green master mix (B21202; Bimake) on Roche PCR480 real-time PCR system. Simultaneous quantification of β-actin mRNA was used as an internal control. The sequences of q-PCR primers are listed in Table 1 .
Sybr green master mix
Manufactured by Selleck Chemicals
Sourced in United States, Germany
SYBR Green Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) analysis. It contains SYBR Green I dye, DNA polymerase, buffer, and dNTPs, providing a complete mixture for the detection and quantification of DNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (12 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Nanodrop 8000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (3 mentions)
Hiscript q rt supermix kit, by Vazyme (2 mentions)
Hiscript 2 q rt supermix, by Vazyme (2 mentions)
Lightcycler 480 2 system, by Roche (2 mentions)
Trizol regent, by Thermo Fisher Scientific (2 mentions)
Hiscript 2 reverse transcriptase kit, by Vazyme (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Quantstudio 6 flex real time pcr system, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Trizol, by Takara Bio (1 mentions)
Quantstudio 6, by Thermo Fisher Scientific (1 mentions)
Cdna synthesis kit, by Toyobo (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Rnase free dnase, by Qiagen (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Viia7 real time pcr instrument, by Thermo Fisher Scientific (1 mentions)
31 protocols using sybr green master mix
1
Real-time PCR Expression Analysis
2
Mcl-1 and Survivin Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells (1x 106 per well) were plated in 6-well plates and cultured overnight, then treated with or without 5 μM niclosamide for 2 h. Total RNA was extracted with TRIzol according to the manufacturer's instructions (Invitrogen, NY, USA). The extracted total RNA was reverse transcribed into complementary DNA (cDNA) by using the cDNA Synthesis Kit (TOYOBO, Osaka, Japan). qPCR was performed using SYBR Green Master Mix (Bimake, TX, USA) and a QuantStudio 6 (Life Technologies, NY, USA). Primer sequence used for real-time PCR (Sangon Biotech, Shanghai) were (5'->3') Mcl-1-F: CAC TTC CGC TTC CTT CCA GT, Mcl-1-R: GGT GGC CAA AAG TCG CCC; survivin-F: AGG ACC ACC GCA TCT CTA CA, survivin-R: TTT CCT TTG CAT GGG GTC GT; GAPDH-F: GAA AGC CTG CCG GTG ACT AA, GAPDH-R: GCC CAA TAC GAC CAA ATC AGA GA. The melting curve analysis was used to monitor each amplification reaction for the absence of non-specific PCR products. The threshold cycle numbers obtained from qPCR were compared to generate the relative copy number. Data were normalized by co-amplification of GAPDH.
3
Quantification of miRNA and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue (either shoot apices with leaf primordia ≤1mm attached or isolated leaf primordia 0.5-1mm in size–as specified in the text) were ground in liquid nitrogen and total RNA extracted using Trizol (Invitrogen) as per the manufacturer’s instructions. RNA was treated with RNAse-free DNAse (Qiagen) and 250ng-1μg of RNA was used for reverse transcription using Superscript III (Invitrogen). Gene specific stem-loop RT primers were used to amplify miR156, miR157, miR172 and SnoR101 sRNAs [67 (link),68 (link)] and a polyT RT primer was used for mRNA amplification. Three-step qPCR of cDNA was carried out using SYBR-Green Master Mix (Bimake). qPCR reactions were run in triplicate and an average was calculated. Relative transcript levels were normalized to snoR101 (for miRNAs) and ACT2 (for mRNAs) and expressed as a ratio of expression to a specified control sample. The qPCR primers used in this study are listed in S1 Table .
4
Quantifying Ccl2 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extracted by TRIzol reagent (15596-08, Life Technologies, CA, USA) was subjected to reverse transcription using PrimeScript RT Master Mix (RR036A, Takara, Japan) according to the manufacturer’s instructions. Then, gene expression was measured using SYBR Green Master Mix (B21703, Bimake, TX, USA). The primers for Ccl2 were as follows: forward primer TTAAAAACCTGGATCGGAACCAA, reverse primer GCATTAGCTTCAGATTTACGGGT.
5
Quantitative Analysis of p19Arf RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was processed and extracted with TRIzol reagent (Life Technologies, 15596018) and Direct-zol RNA MicroPrep Kit (Zymo Research, R2060). RT reaction was performed using High-Capacity RNA-to-cDNA Kit (Applied Biosystems, 4387406). qRT-PCR was then performed using SYBR Green Master Mix (Bimake, B21202) and a ViiA7 Real-Time PCR Instrument (Applied Biosystems). SYBR probes were used to quantitate expression of p19Arf (forward: 5′ AGA GGA TCT TGA GAA GAG GGC C 3′; reverse: 5′ GCA GTT CGA ATC TGC ACC G 3′). Normalization was performed using the housekeeping genes 18S (forward: 5′ CAATTACAGGGCCTCGAAAG 3′; reverse: 5′AAACGGCTACCACATCCAAG). The mRNA was measured in triplicates with each experiment repeated twice.
6
Quantitative Analysis of GFP Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated by using the Genomic DNA Extraction Kit (DP304, Tiangen). Genomic DNA concentration was measured by NanoDrop. Genomic DNA was diluted to 50 ng/μl. qPCR was performed using SYBR Green Master Mix (HY-K0501A, Bimake). Specifically, each PCR (30 μl) contained 0.2 μM of each forward and reverse primer pair, 75 ng of cDNA and 15 μl of SYBR Green qPCR Master Mix. qPCR was carried out as follows: 95°C for 5 min, 40 cycles of (95°C for 15 s and 60°C for 30 s), followed by a melt curve stage: 95°C for 15 s, 60°C for 30 s and 95°C for 15 s. The qPCR experiments were performed using a real-time PCR system, QuantStudio 7 Flex (Life Technologies). Each experiment included biological triplicates and technical duplicates. qPCR was performed to measure the levels of GFP at LMNA (LMNA-F/LMNA-R) and fibrillarin (FBL; FBL-F/FBL-R) loci, which were then normalized to the level of 36B4 (36B4-F/36B4-R). The primer sequences used are listed in Supplementary Table S3 .
7
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR was determined using the mature method [35 (link)]. The PCR instrument and reagent were a StepOnePlus real-time PCR system (Applied Biosystems) and a SYBR Green Master Mix (Bimake, Houston, TX, USA), respectively. Total RNA was extracted with Plant Rneasy Mini Kit (Qiagen, Hilden, Germany). The first cDNA strand was synthesized by A PrimeScript® RT kit (TaKaRa, Dalian, China). Genscript online design software (https://www.genscript.com/tools/pcr-primers-designer , accessed on 16 March 2021) was used to design the primer pairs (Table S3 ). A clustered heat map was drawn using Tbtools software. The reference gene was Actin (HhACT) [14 (link)]. Three independent experiments were conducted. Relative transcript abundances were analyzed using the 2−ΔΔCT method [36 (link)].
8
Real-Time qPCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using RNeasy mini kit (Qiagen, Hilden, Germany) and genomic DNA was removed by treatment with DNase (Qiagen, Hilden, Germany). Total RNA (100 ng) was used in a 20 μl reverse transcriptase reaction to synthesize cDNA using iScript cDNA synthesis kit (Bio-Rad Inc., Hercules, CA, United States). RT reactions were performed for 30 min at 42°C. PCR reactions were performed using Bio-rad CFX96 real time system (Bio-Rad Inc., Hercules, CA, United States) using SYBR green master mix from Bimake (Houston, TX, United States). The thermal cycling program consisted of one denaturation cycle of 5 min at 95°C followed by 40 cycles each of 30 s at 95°C, 30 s at 60°C, and 30 s at 72°C. The primer sequences used are listed in Table 1 . The PCR products were separated by electrophoresis on a 1% Tris-acetate-EDTA agarose gel.
9
Quantitative RT-PCR Analysis of HGSOC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The analyses were performed in 11 HGSOC and 11 FT tissues (Supplementary Table S1 ). The primer of the target genes and β-actin in RT-qPCR were designed and synthesized by Sangon Biotech Co., Ltd (Shanghai, China) (Supplementary Table S2 ). The SuperScript IV cDNA synthesis Kit (Thermo Fisher, Waltham, MA, USA) was used for cDNA synthesis. SYBR Green master mix from Bimake (Munich, German) and the ABI 7500 system (Thermo Fisher, Waltham, MA, USA) was used for RT-PCR. All PCR experiments were conducted in triplicate and the average value was calculated. The gene expression values were normalized to β-actin.
10
Quantitative Analysis of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured cells using Trizol reagent (Invitrogen, USA). First-strand cDNA was synthesized from total RNA using M-MLV reverse transcriptase kit with the stem-loop RT primer of miRNAs and using Multiscribe Reverse Transcriptase kit (Applied Biosystems) with random primers according to the manufacturer’s protocol. Real-time qRT-PCR was performed for miRNAs and U6 using the SYBR Green master mix (Bimake). The relative expression levels of miRNAs were calculated using the 2−ΔΔCt analysis method by normalization to the expression level of U6. The primers used in these experiments are described in Supplementary Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!