Phire reaction buffer

To confirm the sequence immediately upstream of (CAG)₁₅₄ in the Atxn1^154Q/2Q repeats, a NaOH DNA extraction was performed on mouse ear punches and a PCR across the CAG repeat was performed using Atxn1-Rep-Fw (5ʹ CGTGTACCCTCCTCCTCAGT 3ʹ) and Atxn1-Rep-Rv (5ʹ ATTGCACAACCACCTGGGAT 3ʹ) under the following conditions: 1× Phire Hot Start II DNA Polymerase, 1× Phire Reaction Buffer (ThermoFisher), 1 M Betaine (Sigma), 0.4 mM dNTPs (NEB), 0.4 µM Atxn1-Rep-Fw, 0.4 µM Atxn1-Rep-Rv, 0.04 mM 7-deaza-dGTP (Roche); 98°C 7 mins–35 cycles of 98°C 30 s, 65.6°C 30 s, 72°C 75 s–72°C 5 mins. DNA was extracted from PCR bands using EZ-10 Spin Column DNA Gel Extraction Kit (Bio Basic) and sent for DNA sequencing using nested primers Atxn1-Seq-Fw (5ʹ CTTACGCGGGCTTTATCCCT 3ʹ) and Atxn1-Seq-Rv (5ʹ GCGGGATCATCGTCTGATGG 3ʹ).

For injection of mosquito embryos, each gRNA was diluted to 100 ng/μl with E-Toxate water (Sigma) and filtered through a 0.2-μm, 1.5-ml filter (Millipore). The mosquito embryo microinjection was done according to our previously established protocol (39 (link)). For each gRNA or gRNA mix, 200 to 400 exu-Cas9 eggs were injected.
A leg PCR was used to screen the surviving G0 adults for mutations using a pair of primers outside ∼100 bp of each gRNA (Table S2). In brief, one hind leg of the adult mosquito was pulled and transferred to a PCR tube with 20 μl Phire reaction buffer (Thermo Fisher Scientific), then heated at 95°C for 5 min, and 1 μl was used as a template for PCR amplification. PCR mixtures were heated to 95°C for 2 min; followed by 40 cycles at 95°C for 10 s, 58°C for 20 s, and 68°C for 30 s. PCR products were checked on a 2% agarose gel, and an extra band was considered to indicate a mutation induced by gRNA. The mutated PCR products were purified using a DNA Clean & Concentrator kit (Zymo Research), sequenced, and compared to the WT gene to confirm the mutation. The mutated G0 mosquito was then outcrossed with exu-Cas9 mosquitoes. After outcrossing of the Obp mutants with exu-Cas9 mosquitoes for several generations, heterozygous mutants were incrossed, and the mutated homozygotes were identified by leg PCR and confirmed by DNA sequencing.